Mutagenetix > Incidental Mutation

Incidental Mutation 'R0178:Abca1'

23755

Institutional Source

Beutler Lab

Gene Symbol

Abca1

Ensembl Gene

ENSMUSG00000015243

Gene Name

ATP-binding cassette, sub-family A (ABC1), member 1

Synonyms

ABC1

MMRRC Submission

038446-MU

Accession Numbers

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R0178 (G1)

Quality Score

225

Status

Validated (trace)

Chromosome

Chromosomal Location

53030787-53159895 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 53081953 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Aspartic acid to Glycine at position 769 (D769G)

Ref Sequence

ENSEMBL: ENSMUSP00000030010 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000030010]

AlphaFold

P41233

Predicted Effect

possibly damaging
Transcript: ENSMUST00000030010
AA Change: D769G

PolyPhen 2 Score 0.890 (Sensitivity: 0.82; Specificity: 0.94)

SMART Domains

Protein: ENSMUSP00000030010
Gene: ENSMUSG00000015243
AA Change: D769G

Domain	Start	End	E-Value	Type
transmembrane domain	25	47	N/A	INTRINSIC
Pfam:ABC2_membrane_3	395	841	4.9e-14	PFAM
AAA	925	1122	4.2e-10	SMART
low complexity region	1137	1150	N/A	INTRINSIC
Pfam:ABC2_membrane_3	1344	1869	1.7e-53	PFAM
low complexity region	1890	1899	N/A	INTRINSIC
AAA	1938	2123	3.04e-7	SMART
low complexity region	2176	2187	N/A	INTRINSIC
low complexity region	2222	2237	N/A	INTRINSIC

Meta Mutation Damage Score

0.2705

Coding Region Coverage

1x: 98.9%
3x: 98.1%
10x: 95.5%
20x: 88.8%

Validation Efficiency

95% (69/73)

MGI Phenotype

FUNCTION: The membrane-associated protein encoded by this gene is a member of the superfamily of ATP-binding cassette (ABC) transporters. ABC proteins transport various molecules across extra- and intracellular membranes. ABC genes are divided into seven distinct subfamilies (ABC1, MDR/TAP, MRP, ALD, OABP, GCN20, White). This protein is a member of the ABC1 subfamily. Members of the ABC1 subfamily comprise the only major ABC subfamily found exclusively in multicellular eukaryotes. In humans, this protein functions as a cholesterol efflux pump in the cellular lipid removal pathway. Mutations in the human gene have been associated with Tangier's disease and familial high-density lipoprotein deficiency. [provided by RefSeq, Jul 2008]
PHENOTYPE: Many homozygous null mutants die perinatally with placental defects. Survivors show altered steroidogenesis, defective lipid export in Golgi, low serum cholesterol, lipid accumulation in macrophages and lung, reduced fertility and kidney and heart defects. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 53 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700125H20Rik	A	G	11: 85,178,438	H94R	probably benign	Het
4922502D21Rik	T	C	6: 129,326,823	R60G	probably benign	Het
4930596D02Rik	T	G	14: 35,811,478	N111T	probably benign	Het
9930021J03Rik	A	G	19: 29,754,788	S342P	probably damaging	Het
Adcy6	G	T	15: 98,604,215	Q173K	probably benign	Het
Amotl1	G	A	9: 14,548,773	A890V	probably benign	Het
Arfgap2	C	T	2: 91,267,361	A141V	probably benign	Het
Asb2	G	A	12: 103,325,552	P324L	probably damaging	Het
Cacna1g	G	A	11: 94,463,483	T202I	probably damaging	Het
Capn5	A	G	7: 98,132,891	L214P	probably damaging	Het
Cdh20	A	T	1: 104,975,051	D489V	possibly damaging	Het
Cers5	C	A	15: 99,747,024		probably benign	Het
Chrnb3	T	A	8: 27,393,364	V111D	probably damaging	Het
Colec12	C	T	18: 9,858,921	P568L	unknown	Het
Cyp2r1	T	C	7: 114,550,408	E248G	probably damaging	Het
Dnmt3b	A	G	2: 153,675,018	T536A	probably benign	Het
Eef2	G	A	10: 81,180,292	V496M	possibly damaging	Het
Fam118a	T	C	15: 85,045,880		probably benign	Het
Fer1l6	T	A	15: 58,637,914		probably null	Het
Fhad1	A	C	4: 141,955,340	F497V	probably benign	Het
Gbe1	G	A	16: 70,478,386	G358D	probably damaging	Het
Gdf10	A	G	14: 33,924,101	D69G	probably damaging	Het
Ggt6	A	G	11: 72,436,818	H150R	possibly damaging	Het
Gm1966	A	T	7: 106,601,821	Y739N	probably damaging	Het
Gm45713	A	T	7: 45,134,458	L110Q	probably damaging	Het
Gm9847	T	C	12: 14,494,648		noncoding transcript	Het
Grwd1	T	C	7: 45,830,630	E51G	probably damaging	Het
H13	A	G	2: 152,681,067	Y100C	probably damaging	Het
Kcne1	A	C	16: 92,348,809	M49R	probably damaging	Het
Kcnma1	C	T	14: 23,526,767	R236H	probably damaging	Het
Knl1	T	A	2: 119,058,405		probably benign	Het
Krt40	T	C	11: 99,541,739	I150M	probably damaging	Het
Ldb2	A	T	5: 44,473,499	V300E	probably damaging	Het
Lrp1b	A	T	2: 40,725,907	C3606S	probably damaging	Het
Lrrc42	A	G	4: 107,247,720	I16T	probably damaging	Het
Lrrc6	A	C	15: 66,454,101	D208E	probably benign	Het
Mtus1	G	T	8: 41,002,361	L87I	possibly damaging	Het
Myot	T	C	18: 44,336,986	F10S	probably damaging	Het
Nrg3	A	T	14: 38,376,456	H480Q	probably damaging	Het
Olfr205	A	T	16: 59,329,420	F30I	probably damaging	Het
Olfr691	G	A	7: 105,336,922	R265C	probably benign	Het
Prl2c5	A	T	13: 13,191,805	D220V	probably damaging	Het
Rbm17	G	A	2: 11,587,779	S295L	probably benign	Het
Serpina6	A	G	12: 103,646,913	I376T	probably damaging	Het
Sh2d2a	A	T	3: 87,849,423	T192S	probably benign	Het
Slc27a1	T	C	8: 71,584,462	Y417H	possibly damaging	Het
Slc6a1	T	G	6: 114,304,852	I32S	possibly damaging	Het
Sntb1	T	C	15: 55,906,144	T150A	probably damaging	Het
Tanc1	T	A	2: 59,835,447	C1183*	probably null	Het
Tmprss7	C	A	16: 45,690,843	W57C	probably damaging	Het
Ubac1	A	T	2: 26,021,428	V36E	possibly damaging	Het
Zfc3h1	T	C	10: 115,406,725		probably benign	Het
Zfp644	C	T	5: 106,636,905	C592Y	probably damaging	Het

Other mutations in Abca1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00429:Abca1	APN	4	53059255	critical splice donor site	probably null
IGL00778:Abca1	APN	4	53086132	missense	probably benign
IGL01013:Abca1	APN	4	53038185	nonsense	probably null
IGL01510:Abca1	APN	4	53143979	missense	probably damaging	0.97
IGL01608:Abca1	APN	4	53038158	missense	probably damaging	1.00
IGL01845:Abca1	APN	4	53090297	missense	probably damaging	1.00
IGL02048:Abca1	APN	4	53069831	missense	probably damaging	1.00
IGL02249:Abca1	APN	4	53068739	nonsense	probably null
IGL02569:Abca1	APN	4	53034061	missense	probably damaging	1.00
IGL02622:Abca1	APN	4	53034046	missense	probably damaging	0.99
R6720_abca1_529	UTSW	4	53083733	missense	probably damaging	1.00
R0042:Abca1	UTSW	4	53059245	splice site	probably benign
R0042:Abca1	UTSW	4	53059245	splice site	probably benign
R0050:Abca1	UTSW	4	53069910	splice site	probably benign
R0107:Abca1	UTSW	4	53080834	missense	probably benign	0.00
R0127:Abca1	UTSW	4	53067155	missense	probably benign	0.00
R0207:Abca1	UTSW	4	53086039	missense	probably damaging	0.97
R0267:Abca1	UTSW	4	53046105	missense	probably damaging	1.00
R0269:Abca1	UTSW	4	53044228	missense	probably benign
R0586:Abca1	UTSW	4	53092860	missense	probably benign	0.00
R0587:Abca1	UTSW	4	53107035	missense	probably benign	0.00
R1403:Abca1	UTSW	4	53059253	splice site	probably benign
R1404:Abca1	UTSW	4	53059253	splice site	probably benign
R1405:Abca1	UTSW	4	53059253	splice site	probably benign
R1558:Abca1	UTSW	4	53092887	missense	probably null	0.00
R1655:Abca1	UTSW	4	53050964	missense	probably benign
R1662:Abca1	UTSW	4	53090251	splice site	probably null
R1769:Abca1	UTSW	4	53074325	missense	probably damaging	1.00
R1898:Abca1	UTSW	4	53071977	missense	probably benign	0.08
R1945:Abca1	UTSW	4	53061509	frame shift	probably null
R1966:Abca1	UTSW	4	53050409	missense	probably damaging	1.00
R2055:Abca1	UTSW	4	53069881	missense	probably benign
R2185:Abca1	UTSW	4	53089830	missense	probably benign	0.12
R2202:Abca1	UTSW	4	53090291	missense	probably damaging	0.96
R2203:Abca1	UTSW	4	53090291	missense	probably damaging	0.96
R2204:Abca1	UTSW	4	53090291	missense	probably damaging	0.96
R3056:Abca1	UTSW	4	53127626	missense	probably benign
R3849:Abca1	UTSW	4	53061481	splice site	probably benign
R3850:Abca1	UTSW	4	53061481	splice site	probably benign
R3906:Abca1	UTSW	4	53067151	missense	possibly damaging	0.84
R3908:Abca1	UTSW	4	53067151	missense	possibly damaging	0.84
R4050:Abca1	UTSW	4	53044144	missense	probably damaging	1.00
R4204:Abca1	UTSW	4	53090369	missense	probably benign	0.00
R4225:Abca1	UTSW	4	53085106	missense	possibly damaging	0.87
R4577:Abca1	UTSW	4	53062568	missense	possibly damaging	0.94
R4979:Abca1	UTSW	4	53085092	splice site	probably null
R5022:Abca1	UTSW	4	53041570	frame shift	probably null
R5168:Abca1	UTSW	4	53086070	missense	probably benign
R5363:Abca1	UTSW	4	53132963	missense	probably benign	0.00
R5439:Abca1	UTSW	4	53042381	missense	possibly damaging	0.55
R5604:Abca1	UTSW	4	53067168	splice site	probably null
R5614:Abca1	UTSW	4	53046132	missense	probably damaging	1.00
R5810:Abca1	UTSW	4	53079631	missense	probably benign
R6001:Abca1	UTSW	4	53075555	missense	possibly damaging	0.68
R6151:Abca1	UTSW	4	53085261	missense	probably benign
R6185:Abca1	UTSW	4	53078089	missense	probably benign	0.31
R6262:Abca1	UTSW	4	53092917	missense	probably benign	0.01
R6455:Abca1	UTSW	4	53042376	missense	probably damaging	0.98
R6472:Abca1	UTSW	4	53085991	critical splice donor site	probably null
R6564:Abca1	UTSW	4	53034031	missense	possibly damaging	0.85
R6720:Abca1	UTSW	4	53083733	missense	probably damaging	1.00
R6903:Abca1	UTSW	4	53143952	missense	probably benign	0.17
R6960:Abca1	UTSW	4	53072924	missense	probably benign	0.00
R7065:Abca1	UTSW	4	53074233	missense	probably damaging	0.98
R7142:Abca1	UTSW	4	53082050	missense	probably damaging	1.00
R7322:Abca1	UTSW	4	53067151	missense	probably damaging	0.97
R7520:Abca1	UTSW	4	53078114	missense	probably benign
R7547:Abca1	UTSW	4	53109269	missense	probably benign	0.02
R7793:Abca1	UTSW	4	53042367	missense	not run
R7863:Abca1	UTSW	4	53107179	missense	probably benign
R7877:Abca1	UTSW	4	53046135	missense	possibly damaging	0.55
R8010:Abca1	UTSW	4	53127600	missense	probably benign
R8058:Abca1	UTSW	4	53081954	missense	possibly damaging	0.60
R8181:Abca1	UTSW	4	53059303	missense	probably benign	0.21
R8471:Abca1	UTSW	4	53044187	missense	probably damaging	1.00
R8774:Abca1	UTSW	4	53090358	missense	possibly damaging	0.89
R8774-TAIL:Abca1	UTSW	4	53090358	missense	possibly damaging	0.89
R8806:Abca1	UTSW	4	53084520	missense	probably benign	0.17
R8841:Abca1	UTSW	4	53143925	splice site	probably benign
R9081:Abca1	UTSW	4	53109162	critical splice donor site	probably null
R9483:Abca1	UTSW	4	53060351	missense	probably benign	0.11
R9532:Abca1	UTSW	4	53109284	missense	probably benign
R9621:Abca1	UTSW	4	53092918	missense	probably benign	0.00
R9638:Abca1	UTSW	4	53092806	missense	probably damaging	0.96
RF005:Abca1	UTSW	4	53049125	missense	probably damaging	0.97
RF024:Abca1	UTSW	4	53049125	missense	probably damaging	0.97
X0023:Abca1	UTSW	4	53049038	missense	possibly damaging	0.91
Z1177:Abca1	UTSW	4	53079584	missense	probably benign	0.00
Z1177:Abca1	UTSW	4	53080799	missense	probably benign	0.01
Z1177:Abca1	UTSW	4	53086133	missense	possibly damaging	0.73

Predicted Primers

PCR Primer
(F):5'- TCCAACCAGTTCAAGGCACAATCTG -3'
(R):5'- GGCTTGCCAAGGCTACACGTTTATC -3'

Sequencing Primer
(F):5'- GGCACAATCTGATGATCTCTGAC -3'
(R):5'- TCCAGTTAGGAAACCTGCTGC -3'

Posted On

2013-04-16