Incidental Mutation 'R2172:Zfp329'
ID 237552
Institutional Source Beutler Lab
Gene Symbol Zfp329
Ensembl Gene ENSMUSG00000057894
Gene Name zinc finger protein 329
Synonyms
MMRRC Submission 040174-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R2172 (G1)
Quality Score 225
Status Not validated
Chromosome 7
Chromosomal Location 12804977-12818858 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 12810767 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Phenylalanine to Leucine at position 277 (F277L)
Ref Sequence ENSEMBL: ENSMUSP00000113355 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000072222] [ENSMUST00000108546] [ENSMUST00000121215]
AlphaFold Q6GQR8
Predicted Effect probably damaging
Transcript: ENSMUST00000072222
AA Change: F277L

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000072079
Gene: ENSMUSG00000057894
AA Change: F277L

DomainStartEndE-ValueType
low complexity region 147 160 N/A INTRINSIC
ZnF_C2H2 184 206 9.58e-3 SMART
ZnF_C2H2 212 234 1.12e-3 SMART
ZnF_C2H2 240 262 1.22e-4 SMART
ZnF_C2H2 268 290 1.95e-3 SMART
ZnF_C2H2 296 318 2.61e-4 SMART
ZnF_C2H2 324 346 5.14e-3 SMART
ZnF_C2H2 352 374 2.24e-3 SMART
ZnF_C2H2 380 402 5.21e-4 SMART
ZnF_C2H2 408 430 1.92e-2 SMART
ZnF_C2H2 436 458 5.21e-4 SMART
ZnF_C2H2 464 486 3.16e-3 SMART
ZnF_C2H2 492 514 2.2e-2 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000108546
SMART Domains Protein: ENSMUSP00000104186
Gene: ENSMUSG00000057894

DomainStartEndE-ValueType
low complexity region 147 160 N/A INTRINSIC
ZnF_C2H2 184 206 9.58e-3 SMART
ZnF_C2H2 212 234 1.12e-3 SMART
ZnF_C2H2 240 262 1.22e-4 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000121215
AA Change: F277L

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000113355
Gene: ENSMUSG00000057894
AA Change: F277L

DomainStartEndE-ValueType
low complexity region 147 160 N/A INTRINSIC
ZnF_C2H2 184 206 9.58e-3 SMART
ZnF_C2H2 212 234 1.12e-3 SMART
ZnF_C2H2 240 262 1.22e-4 SMART
ZnF_C2H2 268 290 1.95e-3 SMART
ZnF_C2H2 296 318 2.61e-4 SMART
ZnF_C2H2 324 346 5.14e-3 SMART
ZnF_C2H2 352 374 2.24e-3 SMART
ZnF_C2H2 380 402 5.21e-4 SMART
ZnF_C2H2 408 430 1.92e-2 SMART
ZnF_C2H2 436 458 5.21e-4 SMART
ZnF_C2H2 464 486 3.16e-3 SMART
ZnF_C2H2 492 514 2.2e-2 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000129647
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.4%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 64 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Arap3 T A 18: 37,990,560 E441V probably damaging Het
Arfip2 T A 7: 105,637,988 D64V probably damaging Het
Atg9a C A 1: 75,185,685 R527L probably damaging Het
Atp1a1 T G 3: 101,590,548 I308L probably benign Het
Bcan T A 3: 87,996,581 Y199F probably damaging Het
Bsn T C 9: 108,109,992 probably benign Het
Ccdc158 A T 5: 92,632,508 L902H probably damaging Het
Dnah7b A G 1: 46,124,512 Y492C probably benign Het
Dnah9 G T 11: 66,072,779 H1783N probably damaging Het
Dpep2 A G 8: 105,988,998 V320A possibly damaging Het
Dsc2 A G 18: 20,045,502 Y282H probably damaging Het
Egfr C T 11: 16,911,562 P1114S probably benign Het
Fastkd1 A G 2: 69,700,133 S560P probably damaging Het
Gm10696 T G 3: 94,176,298 K69Q possibly damaging Het
Gm14295 G A 2: 176,811,102 R795Q possibly damaging Het
Gpr155 C T 2: 73,382,127 V51I probably benign Het
Gsap G A 5: 21,222,440 probably null Het
Hecw1 T A 13: 14,377,706 I103F probably damaging Het
Herc3 T A 6: 58,887,437 N685K probably damaging Het
Hnrnph1 T A 11: 50,382,816 D244E probably benign Het
Hydin A G 8: 110,582,049 E3989G probably benign Het
Ibsp T C 5: 104,310,430 Y278H probably damaging Het
Ift57 T G 16: 49,759,340 N291K probably benign Het
Il15ra A G 2: 11,723,571 T149A possibly damaging Het
Ints5 C T 19: 8,896,282 T535I possibly damaging Het
Jarid2 T C 13: 44,902,539 L268P probably damaging Het
Klhdc7a T A 4: 139,965,810 T609S probably benign Het
Lrrc49 A G 9: 60,602,682 V429A probably benign Het
Lsm3 T C 6: 91,522,272 V87A possibly damaging Het
Man1c1 G C 4: 134,703,438 P11R probably damaging Het
Map1a G T 2: 121,307,932 V2726L probably damaging Het
Marveld3 A C 8: 109,961,846 S88A probably benign Het
Mcm9 T C 10: 53,548,574 D640G probably damaging Het
Mettl4 A G 17: 94,733,163 I399T probably benign Het
Mmp27 T A 9: 7,577,378 L274* probably null Het
Nacc2 A C 2: 26,060,223 D500E probably benign Het
Nprl3 T A 11: 32,234,894 M372L probably benign Het
Olfr478 A T 7: 108,031,467 I292N probably damaging Het
Otud7b T G 3: 96,153,520 probably null Het
Pcx G A 19: 4,620,881 R1070H probably benign Het
Ptprq C T 10: 107,590,994 W1560* probably null Het
Puf60 A T 15: 76,070,464 I520N probably damaging Het
Qars C T 9: 108,509,200 R143C probably damaging Het
Rfx3 G A 19: 27,815,494 Q322* probably null Het
Samd14 G T 11: 95,014,391 V10L probably benign Het
Setd2 G A 9: 110,549,844 R909Q probably benign Het
Sh2d4a T C 8: 68,296,664 S117P probably benign Het
Sharpin C A 15: 76,350,666 probably benign Het
Skor1 C A 9: 63,145,122 A494S possibly damaging Het
Slc41a2 T C 10: 83,283,774 T375A probably benign Het
Sparc G A 11: 55,395,801 Q324* probably null Het
Srebf1 T C 11: 60,206,502 T171A probably benign Het
Srrd A G 5: 112,341,122 I54T possibly damaging Het
Tecpr1 G T 5: 144,196,417 Q1072K probably damaging Het
Tecpr1 A T 5: 144,211,456 V377E probably benign Het
Tln1 T A 4: 43,545,721 H919L probably benign Het
Tm9sf3 C T 19: 41,217,420 S516N probably damaging Het
Trpa1 T A 1: 14,881,656 T940S probably benign Het
Trpv4 G A 5: 114,644,710 R64C probably damaging Het
Tufm A G 7: 126,488,847 E174G probably benign Het
Urb2 A G 8: 124,031,102 T1183A probably damaging Het
Virma A T 4: 11,527,843 M1245L possibly damaging Het
Vmn2r32 T C 7: 7,474,615 Y259C probably damaging Het
Zfp683 C T 4: 134,055,795 T190I possibly damaging Het
Other mutations in Zfp329
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02501:Zfp329 APN 7 12811179 missense possibly damaging 0.87
IGL02830:Zfp329 APN 7 12810116 missense probably damaging 1.00
R0069:Zfp329 UTSW 7 12810932 missense probably damaging 0.98
R0069:Zfp329 UTSW 7 12810932 missense probably damaging 0.98
R0122:Zfp329 UTSW 7 12810987 missense probably damaging 1.00
R0238:Zfp329 UTSW 7 12810829 missense probably damaging 1.00
R0238:Zfp329 UTSW 7 12810829 missense probably damaging 1.00
R0539:Zfp329 UTSW 7 12806593 critical splice acceptor site probably null
R0570:Zfp329 UTSW 7 12810452 missense probably damaging 1.00
R0682:Zfp329 UTSW 7 12810284 missense probably damaging 1.00
R0811:Zfp329 UTSW 7 12811468 missense probably benign
R0812:Zfp329 UTSW 7 12811468 missense probably benign
R0944:Zfp329 UTSW 7 12811468 missense probably benign
R0945:Zfp329 UTSW 7 12811468 missense probably benign
R0946:Zfp329 UTSW 7 12811468 missense probably benign
R0948:Zfp329 UTSW 7 12811468 missense probably benign
R1632:Zfp329 UTSW 7 12810949 missense possibly damaging 0.63
R1980:Zfp329 UTSW 7 12811468 missense probably benign
R2897:Zfp329 UTSW 7 12810486 missense probably damaging 1.00
R4256:Zfp329 UTSW 7 12807913 missense probably benign 0.03
R4383:Zfp329 UTSW 7 12811657 start gained probably benign
R4384:Zfp329 UTSW 7 12811657 start gained probably benign
R4692:Zfp329 UTSW 7 12810632 missense probably damaging 1.00
R5260:Zfp329 UTSW 7 12806526 unclassified probably benign
R5327:Zfp329 UTSW 7 12811494 missense probably benign 0.04
R5679:Zfp329 UTSW 7 12810031 missense probably damaging 0.96
R6886:Zfp329 UTSW 7 12810098 missense probably benign 0.00
R6904:Zfp329 UTSW 7 12806530 unclassified probably benign
R7304:Zfp329 UTSW 7 12810899 missense probably damaging 1.00
R7564:Zfp329 UTSW 7 12811040 missense probably damaging 1.00
R8130:Zfp329 UTSW 7 12810386 missense probably damaging 1.00
R8310:Zfp329 UTSW 7 12810189 nonsense probably null
R8788:Zfp329 UTSW 7 12810563 missense possibly damaging 0.85
R9206:Zfp329 UTSW 7 12811158 missense probably benign
Predicted Primers PCR Primer
(F):5'- AGCCATCTCGGAAAGCCTTTC -3'
(R):5'- GCCCTGAGCTCATCTCTTAATG -3'

Sequencing Primer
(F):5'- TCCACATCTGCTACACTCATAGGG -3'
(R):5'- AGTCATTCTGCTGAGAAACCG -3'
Posted On 2014-10-02