Incidental Mutation 'R2172:Urb2'
ID 237561
Institutional Source Beutler Lab
Gene Symbol Urb2
Ensembl Gene ENSMUSG00000031976
Gene Name URB2 ribosome biogenesis 2 homolog (S. cerevisiae)
Synonyms
MMRRC Submission 040174-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.946) question?
Stock # R2172 (G1)
Quality Score 225
Status Not validated
Chromosome 8
Chromosomal Location 124021508-124048505 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 124031102 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Threonine to Alanine at position 1183 (T1183A)
Ref Sequence ENSEMBL: ENSMUSP00000133547 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000034457] [ENSMUST00000127664] [ENSMUST00000173168]
AlphaFold E9Q7L1
Predicted Effect probably benign
Transcript: ENSMUST00000034457
AA Change: T1183A

PolyPhen 2 Score 0.428 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000034457
Gene: ENSMUSG00000031976
AA Change: T1183A

DomainStartEndE-ValueType
low complexity region 489 503 N/A INTRINSIC
low complexity region 541 546 N/A INTRINSIC
low complexity region 576 590 N/A INTRINSIC
low complexity region 887 900 N/A INTRINSIC
low complexity region 1073 1092 N/A INTRINSIC
low complexity region 1172 1188 N/A INTRINSIC
low complexity region 1273 1279 N/A INTRINSIC
Pfam:Urb2 1319 1515 2.7e-26 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000127664
SMART Domains Protein: ENSMUSP00000118564
Gene: ENSMUSG00000092329

DomainStartEndE-ValueType
Pfam:Glycos_transf_2 104 287 7.4e-31 PFAM
Pfam:Glyco_transf_7C 261 331 4.9e-8 PFAM
RICIN 406 531 9.28e-27 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000173168
AA Change: T1183A

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000133547
Gene: ENSMUSG00000031976
AA Change: T1183A

DomainStartEndE-ValueType
low complexity region 489 503 N/A INTRINSIC
low complexity region 541 546 N/A INTRINSIC
low complexity region 576 590 N/A INTRINSIC
low complexity region 887 900 N/A INTRINSIC
low complexity region 1073 1092 N/A INTRINSIC
low complexity region 1172 1188 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000212460
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.4%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 64 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Arap3 T A 18: 37,990,560 E441V probably damaging Het
Arfip2 T A 7: 105,637,988 D64V probably damaging Het
Atg9a C A 1: 75,185,685 R527L probably damaging Het
Atp1a1 T G 3: 101,590,548 I308L probably benign Het
Bcan T A 3: 87,996,581 Y199F probably damaging Het
Bsn T C 9: 108,109,992 probably benign Het
Ccdc158 A T 5: 92,632,508 L902H probably damaging Het
Dnah7b A G 1: 46,124,512 Y492C probably benign Het
Dnah9 G T 11: 66,072,779 H1783N probably damaging Het
Dpep2 A G 8: 105,988,998 V320A possibly damaging Het
Dsc2 A G 18: 20,045,502 Y282H probably damaging Het
Egfr C T 11: 16,911,562 P1114S probably benign Het
Fastkd1 A G 2: 69,700,133 S560P probably damaging Het
Gm10696 T G 3: 94,176,298 K69Q possibly damaging Het
Gm14295 G A 2: 176,811,102 R795Q possibly damaging Het
Gpr155 C T 2: 73,382,127 V51I probably benign Het
Gsap G A 5: 21,222,440 probably null Het
Hecw1 T A 13: 14,377,706 I103F probably damaging Het
Herc3 T A 6: 58,887,437 N685K probably damaging Het
Hnrnph1 T A 11: 50,382,816 D244E probably benign Het
Hydin A G 8: 110,582,049 E3989G probably benign Het
Ibsp T C 5: 104,310,430 Y278H probably damaging Het
Ift57 T G 16: 49,759,340 N291K probably benign Het
Il15ra A G 2: 11,723,571 T149A possibly damaging Het
Ints5 C T 19: 8,896,282 T535I possibly damaging Het
Jarid2 T C 13: 44,902,539 L268P probably damaging Het
Klhdc7a T A 4: 139,965,810 T609S probably benign Het
Lrrc49 A G 9: 60,602,682 V429A probably benign Het
Lsm3 T C 6: 91,522,272 V87A possibly damaging Het
Man1c1 G C 4: 134,703,438 P11R probably damaging Het
Map1a G T 2: 121,307,932 V2726L probably damaging Het
Marveld3 A C 8: 109,961,846 S88A probably benign Het
Mcm9 T C 10: 53,548,574 D640G probably damaging Het
Mettl4 A G 17: 94,733,163 I399T probably benign Het
Mmp27 T A 9: 7,577,378 L274* probably null Het
Nacc2 A C 2: 26,060,223 D500E probably benign Het
Nprl3 T A 11: 32,234,894 M372L probably benign Het
Olfr478 A T 7: 108,031,467 I292N probably damaging Het
Otud7b T G 3: 96,153,520 probably null Het
Pcx G A 19: 4,620,881 R1070H probably benign Het
Ptprq C T 10: 107,590,994 W1560* probably null Het
Puf60 A T 15: 76,070,464 I520N probably damaging Het
Qars C T 9: 108,509,200 R143C probably damaging Het
Rfx3 G A 19: 27,815,494 Q322* probably null Het
Samd14 G T 11: 95,014,391 V10L probably benign Het
Setd2 G A 9: 110,549,844 R909Q probably benign Het
Sh2d4a T C 8: 68,296,664 S117P probably benign Het
Sharpin C A 15: 76,350,666 probably benign Het
Skor1 C A 9: 63,145,122 A494S possibly damaging Het
Slc41a2 T C 10: 83,283,774 T375A probably benign Het
Sparc G A 11: 55,395,801 Q324* probably null Het
Srebf1 T C 11: 60,206,502 T171A probably benign Het
Srrd A G 5: 112,341,122 I54T possibly damaging Het
Tecpr1 G T 5: 144,196,417 Q1072K probably damaging Het
Tecpr1 A T 5: 144,211,456 V377E probably benign Het
Tln1 T A 4: 43,545,721 H919L probably benign Het
Tm9sf3 C T 19: 41,217,420 S516N probably damaging Het
Trpa1 T A 1: 14,881,656 T940S probably benign Het
Trpv4 G A 5: 114,644,710 R64C probably damaging Het
Tufm A G 7: 126,488,847 E174G probably benign Het
Virma A T 4: 11,527,843 M1245L possibly damaging Het
Vmn2r32 T C 7: 7,474,615 Y259C probably damaging Het
Zfp329 A G 7: 12,810,767 F277L probably damaging Het
Zfp683 C T 4: 134,055,795 T190I possibly damaging Het
Other mutations in Urb2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00485:Urb2 APN 8 124028694 missense probably damaging 1.00
IGL00705:Urb2 APN 8 124036637 missense probably benign 0.00
IGL02090:Urb2 APN 8 124028237 missense probably benign 0.28
IGL02707:Urb2 APN 8 124030686 missense probably benign 0.04
IGL03103:Urb2 APN 8 124029752 missense probably benign 0.17
IGL03402:Urb2 APN 8 124029849 missense possibly damaging 0.92
R0037:Urb2 UTSW 8 124047195 missense probably damaging 1.00
R0113:Urb2 UTSW 8 124030926 missense probably benign 0.00
R0883:Urb2 UTSW 8 124030970 nonsense probably null
R1015:Urb2 UTSW 8 124029434 missense probably damaging 1.00
R1265:Urb2 UTSW 8 124025153 missense probably damaging 1.00
R1463:Urb2 UTSW 8 124030908 missense probably benign 0.04
R1497:Urb2 UTSW 8 124028077 missense probably damaging 1.00
R1556:Urb2 UTSW 8 124030617 missense probably damaging 1.00
R1622:Urb2 UTSW 8 124029624 missense probably benign
R1914:Urb2 UTSW 8 124029798 missense possibly damaging 0.81
R1915:Urb2 UTSW 8 124029798 missense possibly damaging 0.81
R2240:Urb2 UTSW 8 124030139 missense probably benign 0.02
R2424:Urb2 UTSW 8 124030426 missense probably benign 0.02
R4085:Urb2 UTSW 8 124030941 missense probably benign 0.02
R4119:Urb2 UTSW 8 124047240 missense probably benign 0.00
R4732:Urb2 UTSW 8 124028897 missense probably damaging 1.00
R4733:Urb2 UTSW 8 124028897 missense probably damaging 1.00
R4865:Urb2 UTSW 8 124029635 nonsense probably null
R5005:Urb2 UTSW 8 124031181 missense probably damaging 0.97
R5381:Urb2 UTSW 8 124029912 missense probably benign 0.02
R5704:Urb2 UTSW 8 124038182 missense probably damaging 0.97
R5891:Urb2 UTSW 8 124030856 missense possibly damaging 0.64
R5958:Urb2 UTSW 8 124029659 missense probably benign 0.01
R5966:Urb2 UTSW 8 124028088 missense probably benign 0.00
R6133:Urb2 UTSW 8 124028561 nonsense probably null
R6136:Urb2 UTSW 8 124030092 missense probably benign
R6341:Urb2 UTSW 8 124031125 missense probably damaging 0.99
R6343:Urb2 UTSW 8 124031125 missense probably damaging 0.99
R6344:Urb2 UTSW 8 124031125 missense probably damaging 0.99
R6417:Urb2 UTSW 8 124047199 missense probably damaging 1.00
R6420:Urb2 UTSW 8 124047199 missense probably damaging 1.00
R6585:Urb2 UTSW 8 124031125 missense probably damaging 0.99
R6586:Urb2 UTSW 8 124031125 missense probably damaging 0.99
R6587:Urb2 UTSW 8 124031125 missense probably damaging 0.99
R6588:Urb2 UTSW 8 124031125 missense probably damaging 0.99
R7061:Urb2 UTSW 8 124028297 missense probably benign
R7090:Urb2 UTSW 8 124030599 missense probably benign
R7371:Urb2 UTSW 8 124028269 missense probably benign 0.00
R7467:Urb2 UTSW 8 124028511 missense probably benign
R7542:Urb2 UTSW 8 124028588 missense probably benign
R7545:Urb2 UTSW 8 124029752 missense probably benign 0.00
R7686:Urb2 UTSW 8 124045172 missense probably benign 0.01
R8046:Urb2 UTSW 8 124028032 missense possibly damaging 0.92
R8101:Urb2 UTSW 8 124028040 missense probably benign 0.01
R8404:Urb2 UTSW 8 124025203 missense probably damaging 1.00
R8879:Urb2 UTSW 8 124028403 missense probably benign 0.27
R9141:Urb2 UTSW 8 124028546 missense probably damaging 1.00
R9174:Urb2 UTSW 8 124041248 missense possibly damaging 0.75
R9184:Urb2 UTSW 8 124045151 missense probably benign 0.10
R9304:Urb2 UTSW 8 124030508 missense probably benign
R9309:Urb2 UTSW 8 124028070 missense probably damaging 1.00
R9328:Urb2 UTSW 8 124047295 missense probably damaging 1.00
R9415:Urb2 UTSW 8 124029874 missense possibly damaging 0.72
R9426:Urb2 UTSW 8 124028546 missense probably damaging 1.00
R9429:Urb2 UTSW 8 124023487 nonsense probably null
X0020:Urb2 UTSW 8 124030983 missense possibly damaging 0.91
X0027:Urb2 UTSW 8 124028814 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGTAGACATGAGCCAGCACCTC -3'
(R):5'- TGCAGCACAGAATCAGCTCAG -3'

Sequencing Primer
(F):5'- ACCTCAGGGACGGACAG -3'
(R):5'- CAGTTACTTCAGTGCCAGGAGATC -3'
Posted On 2014-10-02