Incidental Mutation 'R2172:Mmp27'
ID 237562
Institutional Source Beutler Lab
Gene Symbol Mmp27
Ensembl Gene ENSMUSG00000070323
Gene Name matrix metallopeptidase 27
Synonyms LOC234911
MMRRC Submission 040174-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.066) question?
Stock # R2172 (G1)
Quality Score 225
Status Not validated
Chromosome 9
Chromosomal Location 7571396-7581885 bp(+) (GRCm38)
Type of Mutation nonsense
DNA Base Change (assembly) T to A at 7577378 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Leucine to Stop codon at position 274 (L274*)
Ref Sequence ENSEMBL: ENSMUSP00000117469 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000120900] [ENSMUST00000151853]
AlphaFold D3YV89
Predicted Effect probably null
Transcript: ENSMUST00000093896
AA Change: L274*
SMART Domains Protein: ENSMUSP00000091423
Gene: ENSMUSG00000070323
AA Change: L274*

DomainStartEndE-ValueType
Pfam:PG_binding_1 40 100 1.4e-13 PFAM
ZnMc 116 303 1.81e-43 SMART
HX 326 368 5.97e-4 SMART
HX 370 412 1.1e-7 SMART
HX 417 464 1.09e-6 SMART
HX 466 506 3.2e-4 SMART
Predicted Effect probably null
Transcript: ENSMUST00000120900
AA Change: L248*
SMART Domains Protein: ENSMUSP00000113231
Gene: ENSMUSG00000070323
AA Change: L248*

DomainStartEndE-ValueType
Pfam:PG_binding_1 40 100 1e-13 PFAM
ZnMc 116 277 1.76e-50 SMART
HX 300 342 5.97e-4 SMART
HX 344 386 1.1e-7 SMART
HX 391 438 1.09e-6 SMART
HX 440 480 3.2e-4 SMART
Predicted Effect probably null
Transcript: ENSMUST00000151853
AA Change: L274*
SMART Domains Protein: ENSMUSP00000117469
Gene: ENSMUSG00000070323
AA Change: L274*

DomainStartEndE-ValueType
Pfam:PG_binding_1 40 100 1.1e-13 PFAM
ZnMc 116 303 1.81e-43 SMART
HX 326 368 5.97e-4 SMART
HX 370 412 1.1e-7 SMART
HX 417 464 1.09e-6 SMART
HX 466 506 3.2e-4 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000152878
SMART Domains Protein: ENSMUSP00000116263
Gene: ENSMUSG00000070323

DomainStartEndE-ValueType
Pfam:PG_binding_1 39 99 1.1e-13 PFAM
ZnMc 115 295 1.41e-13 SMART
HX 245 287 5.97e-4 SMART
HX 289 331 1.1e-7 SMART
HX 336 383 1.09e-6 SMART
HX 385 425 3.2e-4 SMART
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Proteins of the matrix metalloproteinase (MMP) family are involved in the breakdown of extracellular matrix in normal physiological processes, such as embryonic development, reproduction, and tissue remodeling, as well as in disease processes, such as arthritis and metastasis. Most MMP's are secreted as inactive proproteins which are activated when cleaved by extracellular proteinases. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 64 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Arap3 T A 18: 37,990,560 E441V probably damaging Het
Arfip2 T A 7: 105,637,988 D64V probably damaging Het
Atg9a C A 1: 75,185,685 R527L probably damaging Het
Atp1a1 T G 3: 101,590,548 I308L probably benign Het
Bcan T A 3: 87,996,581 Y199F probably damaging Het
Bsn T C 9: 108,109,992 probably benign Het
Ccdc158 A T 5: 92,632,508 L902H probably damaging Het
Dnah7b A G 1: 46,124,512 Y492C probably benign Het
Dnah9 G T 11: 66,072,779 H1783N probably damaging Het
Dpep2 A G 8: 105,988,998 V320A possibly damaging Het
Dsc2 A G 18: 20,045,502 Y282H probably damaging Het
Egfr C T 11: 16,911,562 P1114S probably benign Het
Fastkd1 A G 2: 69,700,133 S560P probably damaging Het
Gm10696 T G 3: 94,176,298 K69Q possibly damaging Het
Gm14295 G A 2: 176,811,102 R795Q possibly damaging Het
Gpr155 C T 2: 73,382,127 V51I probably benign Het
Gsap G A 5: 21,222,440 probably null Het
Hecw1 T A 13: 14,377,706 I103F probably damaging Het
Herc3 T A 6: 58,887,437 N685K probably damaging Het
Hnrnph1 T A 11: 50,382,816 D244E probably benign Het
Hydin A G 8: 110,582,049 E3989G probably benign Het
Ibsp T C 5: 104,310,430 Y278H probably damaging Het
Ift57 T G 16: 49,759,340 N291K probably benign Het
Il15ra A G 2: 11,723,571 T149A possibly damaging Het
Ints5 C T 19: 8,896,282 T535I possibly damaging Het
Jarid2 T C 13: 44,902,539 L268P probably damaging Het
Klhdc7a T A 4: 139,965,810 T609S probably benign Het
Lrrc49 A G 9: 60,602,682 V429A probably benign Het
Lsm3 T C 6: 91,522,272 V87A possibly damaging Het
Man1c1 G C 4: 134,703,438 P11R probably damaging Het
Map1a G T 2: 121,307,932 V2726L probably damaging Het
Marveld3 A C 8: 109,961,846 S88A probably benign Het
Mcm9 T C 10: 53,548,574 D640G probably damaging Het
Mettl4 A G 17: 94,733,163 I399T probably benign Het
Nacc2 A C 2: 26,060,223 D500E probably benign Het
Nprl3 T A 11: 32,234,894 M372L probably benign Het
Olfr478 A T 7: 108,031,467 I292N probably damaging Het
Otud7b T G 3: 96,153,520 probably null Het
Pcx G A 19: 4,620,881 R1070H probably benign Het
Ptprq C T 10: 107,590,994 W1560* probably null Het
Puf60 A T 15: 76,070,464 I520N probably damaging Het
Qars C T 9: 108,509,200 R143C probably damaging Het
Rfx3 G A 19: 27,815,494 Q322* probably null Het
Samd14 G T 11: 95,014,391 V10L probably benign Het
Setd2 G A 9: 110,549,844 R909Q probably benign Het
Sh2d4a T C 8: 68,296,664 S117P probably benign Het
Sharpin C A 15: 76,350,666 probably benign Het
Skor1 C A 9: 63,145,122 A494S possibly damaging Het
Slc41a2 T C 10: 83,283,774 T375A probably benign Het
Sparc G A 11: 55,395,801 Q324* probably null Het
Srebf1 T C 11: 60,206,502 T171A probably benign Het
Srrd A G 5: 112,341,122 I54T possibly damaging Het
Tecpr1 G T 5: 144,196,417 Q1072K probably damaging Het
Tecpr1 A T 5: 144,211,456 V377E probably benign Het
Tln1 T A 4: 43,545,721 H919L probably benign Het
Tm9sf3 C T 19: 41,217,420 S516N probably damaging Het
Trpa1 T A 1: 14,881,656 T940S probably benign Het
Trpv4 G A 5: 114,644,710 R64C probably damaging Het
Tufm A G 7: 126,488,847 E174G probably benign Het
Urb2 A G 8: 124,031,102 T1183A probably damaging Het
Virma A T 4: 11,527,843 M1245L possibly damaging Het
Vmn2r32 T C 7: 7,474,615 Y259C probably damaging Het
Zfp329 A G 7: 12,810,767 F277L probably damaging Het
Zfp683 C T 4: 134,055,795 T190I possibly damaging Het
Other mutations in Mmp27
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00544:Mmp27 APN 9 7573504 splice site probably benign
IGL00656:Mmp27 APN 9 7581382 missense possibly damaging 0.80
IGL00937:Mmp27 APN 9 7578899 critical splice acceptor site probably benign 0.00
IGL01101:Mmp27 APN 9 7573415 missense probably damaging 1.00
IGL01134:Mmp27 APN 9 7573297 missense probably benign 0.06
IGL01631:Mmp27 APN 9 7573288 critical splice acceptor site probably benign 0.00
IGL02967:Mmp27 APN 9 7571590 missense probably benign 0.03
IGL03024:Mmp27 APN 9 7581376 missense probably benign 0.17
R0662:Mmp27 UTSW 9 7577650 missense probably benign 0.00
R0715:Mmp27 UTSW 9 7581155 splice site probably benign
R0826:Mmp27 UTSW 9 7579009 missense probably damaging 1.00
R1191:Mmp27 UTSW 9 7579066 splice site probably null
R1793:Mmp27 UTSW 9 7571458 start codon destroyed probably null 0.00
R1983:Mmp27 UTSW 9 7578897 splice site probably null
R2074:Mmp27 UTSW 9 7577739 missense possibly damaging 0.50
R2445:Mmp27 UTSW 9 7581181 missense probably benign 0.12
R2961:Mmp27 UTSW 9 7573602 missense probably damaging 1.00
R4825:Mmp27 UTSW 9 7581194 missense probably damaging 1.00
R4888:Mmp27 UTSW 9 7581368 missense probably benign 0.00
R4938:Mmp27 UTSW 9 7578982 missense probably damaging 0.97
R5095:Mmp27 UTSW 9 7572158 missense probably damaging 1.00
R5095:Mmp27 UTSW 9 7579000 missense probably damaging 1.00
R5121:Mmp27 UTSW 9 7581368 missense probably benign 0.00
R5446:Mmp27 UTSW 9 7573515 splice site probably benign
R5485:Mmp27 UTSW 9 7573362 missense probably damaging 1.00
R5516:Mmp27 UTSW 9 7579062 missense probably null 1.00
R6682:Mmp27 UTSW 9 7573605 missense probably benign 0.02
R6712:Mmp27 UTSW 9 7572176 missense probably damaging 1.00
R6737:Mmp27 UTSW 9 7571954 missense possibly damaging 0.78
R7282:Mmp27 UTSW 9 7578230 missense probably damaging 0.98
R7368:Mmp27 UTSW 9 7577317 missense probably damaging 1.00
R7689:Mmp27 UTSW 9 7579001 missense probably damaging 1.00
R8006:Mmp27 UTSW 9 7578984 missense probably damaging 0.97
R8185:Mmp27 UTSW 9 7573491 missense unknown
R8537:Mmp27 UTSW 9 7579775 missense probably benign 0.00
R9039:Mmp27 UTSW 9 7581249 missense probably benign 0.01
R9087:Mmp27 UTSW 9 7579857 missense probably damaging 1.00
R9188:Mmp27 UTSW 9 7579791 missense possibly damaging 0.55
R9280:Mmp27 UTSW 9 7579811 missense probably benign 0.09
R9367:Mmp27 UTSW 9 7573549 missense probably damaging 1.00
X0021:Mmp27 UTSW 9 7573298 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TCAAATTGGTGGCTCCATTTC -3'
(R):5'- TATTTCAGGAAGCAACCCTCTC -3'

Sequencing Primer
(F):5'- ACCATGTAAACTTGGCTGGC -3'
(R):5'- TTCAGGAAGCAACCCTCTCAATTTC -3'
Posted On 2014-10-02