Mutagenetix > Incidental Mutation

Incidental Mutation 'R2172:Bsn'

237565

Institutional Source

Beutler Lab

Gene Symbol

Bsn

Ensembl Gene

ENSMUSG00000032589

Gene Name

bassoon

Synonyms

presynaptic cytomatrix protein

MMRRC Submission

040174-MU

Accession Numbers

Genbank: NM_007567; MGI: 1277955

Essential gene?

Possibly non essential (E-score: 0.383) question?

Stock #

R2172 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

108096022-108190384 bp(-) (GRCm38)

Type of Mutation

intron

DNA Base Change (assembly)

T to C at 108109992 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Gene Model

predicted gene model for transcript(s): [ENSMUST00000035208]

AlphaFold

no structure available at present

Predicted Effect

unknown
Transcript: ENSMUST00000035208
AA Change: T2854A

SMART Domains

Protein: ENSMUSP00000035208
Gene: ENSMUSG00000032589
AA Change: T2854A

Domain	Start	End	E-Value	Type
low complexity region	4	40	N/A	INTRINSIC
low complexity region	42	77	N/A	INTRINSIC
Pfam:zf-piccolo	165	223	6.1e-30	PFAM
low complexity region	394	409	N/A	INTRINSIC
low complexity region	445	454	N/A	INTRINSIC
Pfam:zf-piccolo	462	520	5.2e-31	PFAM
low complexity region	527	540	N/A	INTRINSIC
low complexity region	627	643	N/A	INTRINSIC
low complexity region	664	681	N/A	INTRINSIC
low complexity region	694	708	N/A	INTRINSIC
low complexity region	788	803	N/A	INTRINSIC
low complexity region	994	1021	N/A	INTRINSIC
coiled coil region	1047	1101	N/A	INTRINSIC
low complexity region	1131	1145	N/A	INTRINSIC
low complexity region	1173	1190	N/A	INTRINSIC
low complexity region	1209	1220	N/A	INTRINSIC
low complexity region	1333	1343	N/A	INTRINSIC
low complexity region	1443	1455	N/A	INTRINSIC
low complexity region	1481	1498	N/A	INTRINSIC
low complexity region	1790	1800	N/A	INTRINSIC
low complexity region	2117	2126	N/A	INTRINSIC
low complexity region	2287	2303	N/A	INTRINSIC
low complexity region	2326	2356	N/A	INTRINSIC
SCOP:d1eq1a_	2362	2477	2e-7	SMART
low complexity region	2607	2614	N/A	INTRINSIC
low complexity region	2635	2651	N/A	INTRINSIC
low complexity region	2655	2672	N/A	INTRINSIC
coiled coil region	2949	2990	N/A	INTRINSIC
low complexity region	3057	3071	N/A	INTRINSIC
low complexity region	3089	3114	N/A	INTRINSIC
low complexity region	3446	3461	N/A	INTRINSIC
low complexity region	3520	3534	N/A	INTRINSIC
low complexity region	3653	3666	N/A	INTRINSIC
low complexity region	3750	3820	N/A	INTRINSIC
low complexity region	3831	3852	N/A	INTRINSIC
low complexity region	3856	3901	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000124763

Coding Region Coverage

1x: 99.2%
3x: 98.7%
10x: 97.4%
20x: 95.4%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Neurotransmitters are released from a specific site in the axon terminal called the active zone, which is composed of synaptic vesicles and a meshwork of cytoskeleton underlying the plasma membrane. The protein encoded by this gene is thought to be a scaffolding protein involved in organizing the presynaptic cytoskeleton. The gene is expressed primarily in neurons in the brain. A similar gene product in rodents is concentrated in the active zone of axon terminals and tightly associated with cytoskeletal structures, and is essential for regulating neurotransmitter release from a subset of synapses. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mutants lacking functional protein exhibit impaired hippocampal and photoreceptor synaptic transmission, aberrant photoreceptor ribbon synapse formation, and spontaneous epileptic seizures. [provided by MGI curators]

Allele List at MGI

All alleles(9) : Targeted, other(1) Gene trapped(8)

Other mutations in this stock

Total: 64 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Arap3	T	A	18: 37,990,560	E441V	probably damaging	Het
Arfip2	T	A	7: 105,637,988	D64V	probably damaging	Het
Atg9a	C	A	1: 75,185,685	R527L	probably damaging	Het
Atp1a1	T	G	3: 101,590,548	I308L	probably benign	Het
Bcan	T	A	3: 87,996,581	Y199F	probably damaging	Het
Ccdc158	A	T	5: 92,632,508	L902H	probably damaging	Het
Dnah7b	A	G	1: 46,124,512	Y492C	probably benign	Het
Dnah9	G	T	11: 66,072,779	H1783N	probably damaging	Het
Dpep2	A	G	8: 105,988,998	V320A	possibly damaging	Het
Dsc2	A	G	18: 20,045,502	Y282H	probably damaging	Het
Egfr	C	T	11: 16,911,562	P1114S	probably benign	Het
Fastkd1	A	G	2: 69,700,133	S560P	probably damaging	Het
Gm10696	T	G	3: 94,176,298	K69Q	possibly damaging	Het
Gm14295	G	A	2: 176,811,102	R795Q	possibly damaging	Het
Gpr155	C	T	2: 73,382,127	V51I	probably benign	Het
Gsap	G	A	5: 21,222,440		probably null	Het
Hecw1	T	A	13: 14,377,706	I103F	probably damaging	Het
Herc3	T	A	6: 58,887,437	N685K	probably damaging	Het
Hnrnph1	T	A	11: 50,382,816	D244E	probably benign	Het
Hydin	A	G	8: 110,582,049	E3989G	probably benign	Het
Ibsp	T	C	5: 104,310,430	Y278H	probably damaging	Het
Ift57	T	G	16: 49,759,340	N291K	probably benign	Het
Il15ra	A	G	2: 11,723,571	T149A	possibly damaging	Het
Ints5	C	T	19: 8,896,282	T535I	possibly damaging	Het
Jarid2	T	C	13: 44,902,539	L268P	probably damaging	Het
Klhdc7a	T	A	4: 139,965,810	T609S	probably benign	Het
Lrrc49	A	G	9: 60,602,682	V429A	probably benign	Het
Lsm3	T	C	6: 91,522,272	V87A	possibly damaging	Het
Man1c1	G	C	4: 134,703,438	P11R	probably damaging	Het
Map1a	G	T	2: 121,307,932	V2726L	probably damaging	Het
Marveld3	A	C	8: 109,961,846	S88A	probably benign	Het
Mcm9	T	C	10: 53,548,574	D640G	probably damaging	Het
Mettl4	A	G	17: 94,733,163	I399T	probably benign	Het
Mmp27	T	A	9: 7,577,378	L274*	probably null	Het
Nacc2	A	C	2: 26,060,223	D500E	probably benign	Het
Nprl3	T	A	11: 32,234,894	M372L	probably benign	Het
Olfr478	A	T	7: 108,031,467	I292N	probably damaging	Het
Otud7b	T	G	3: 96,153,520		probably null	Het
Pcx	G	A	19: 4,620,881	R1070H	probably benign	Het
Ptprq	C	T	10: 107,590,994	W1560*	probably null	Het
Puf60	A	T	15: 76,070,464	I520N	probably damaging	Het
Qars	C	T	9: 108,509,200	R143C	probably damaging	Het
Rfx3	G	A	19: 27,815,494	Q322*	probably null	Het
Samd14	G	T	11: 95,014,391	V10L	probably benign	Het
Setd2	G	A	9: 110,549,844	R909Q	probably benign	Het
Sh2d4a	T	C	8: 68,296,664	S117P	probably benign	Het
Sharpin	C	A	15: 76,350,666		probably benign	Het
Skor1	C	A	9: 63,145,122	A494S	possibly damaging	Het
Slc41a2	T	C	10: 83,283,774	T375A	probably benign	Het
Sparc	G	A	11: 55,395,801	Q324*	probably null	Het
Srebf1	T	C	11: 60,206,502	T171A	probably benign	Het
Srrd	A	G	5: 112,341,122	I54T	possibly damaging	Het
Tecpr1	G	T	5: 144,196,417	Q1072K	probably damaging	Het
Tecpr1	A	T	5: 144,211,456	V377E	probably benign	Het
Tln1	T	A	4: 43,545,721	H919L	probably benign	Het
Tm9sf3	C	T	19: 41,217,420	S516N	probably damaging	Het
Trpa1	T	A	1: 14,881,656	T940S	probably benign	Het
Trpv4	G	A	5: 114,644,710	R64C	probably damaging	Het
Tufm	A	G	7: 126,488,847	E174G	probably benign	Het
Urb2	A	G	8: 124,031,102	T1183A	probably damaging	Het
Virma	A	T	4: 11,527,843	M1245L	possibly damaging	Het
Vmn2r32	T	C	7: 7,474,615	Y259C	probably damaging	Het
Zfp329	A	G	7: 12,810,767	F277L	probably damaging	Het
Zfp683	C	T	4: 134,055,795	T190I	possibly damaging	Het

Other mutations in Bsn

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00161:Bsn	APN	9	108115110	missense	probably benign	0.01
IGL00330:Bsn	APN	9	108115340	missense	probably damaging	1.00
IGL00863:Bsn	APN	9	108115322	missense	probably damaging	1.00
IGL01123:Bsn	APN	9	108115986	missense	probably damaging	1.00
IGL01330:Bsn	APN	9	108110913	unclassified	probably benign
IGL01336:Bsn	APN	9	108111785	missense	probably damaging	0.99
IGL01399:Bsn	APN	9	108107187	missense	unknown
IGL01683:Bsn	APN	9	108114896	missense	possibly damaging	0.71
IGL02022:Bsn	APN	9	108110418	unclassified	probably benign
IGL02396:Bsn	APN	9	108116046	missense	possibly damaging	0.90
IGL02538:Bsn	APN	9	108105236	missense	unknown
IGL02565:Bsn	APN	9	108113288	missense	probably damaging	0.99
IGL02661:Bsn	APN	9	108106936	nonsense	probably null
IGL02739:Bsn	APN	9	108112546	missense	probably benign	0.14
IGL02951:Bsn	APN	9	108115613	missense	probably damaging	1.00
IGL02987:Bsn	APN	9	108126304	missense	probably benign	0.03
IGL03033:Bsn	APN	9	108115993	missense	probably damaging	1.00
IGL03069:Bsn	APN	9	108114263	missense	probably damaging	1.00
IGL03076:Bsn	APN	9	108105382	missense	unknown
R0068:Bsn	UTSW	9	108112137	missense	probably damaging	1.00
R0068:Bsn	UTSW	9	108112137	missense	probably damaging	1.00
R0167:Bsn	UTSW	9	108125986	missense	probably benign	0.01
R0234:Bsn	UTSW	9	108116396	missense	possibly damaging	0.50
R0234:Bsn	UTSW	9	108116396	missense	possibly damaging	0.50
R0359:Bsn	UTSW	9	108111846	missense	possibly damaging	0.81
R0514:Bsn	UTSW	9	108125782	missense	probably benign	0.07
R0593:Bsn	UTSW	9	108110306	missense	unknown
R0617:Bsn	UTSW	9	108107240	missense	unknown
R0636:Bsn	UTSW	9	108107834	missense	unknown
R0652:Bsn	UTSW	9	108105742	missense	unknown
R0718:Bsn	UTSW	9	108111360	unclassified	probably benign
R0730:Bsn	UTSW	9	108106812	missense	unknown
R0905:Bsn	UTSW	9	108105635	missense	unknown
R0963:Bsn	UTSW	9	108111807	missense	possibly damaging	0.81
R0992:Bsn	UTSW	9	108114354	nonsense	probably null
R1101:Bsn	UTSW	9	108116411	missense	probably damaging	1.00
R1393:Bsn	UTSW	9	108110517	unclassified	probably benign
R1490:Bsn	UTSW	9	108113994	missense	probably benign	0.03
R1566:Bsn	UTSW	9	108125985	missense	probably benign	0.35
R1582:Bsn	UTSW	9	108105092	missense	unknown
R1738:Bsn	UTSW	9	108106934	missense	unknown
R1867:Bsn	UTSW	9	108106719	missense	unknown
R1918:Bsn	UTSW	9	108107573	missense	unknown
R1933:Bsn	UTSW	9	108116444	missense	possibly damaging	0.91
R1946:Bsn	UTSW	9	108114651	missense	probably damaging	0.99
R1978:Bsn	UTSW	9	108114549	missense	probably benign	0.35
R2068:Bsn	UTSW	9	108110684	unclassified	probably benign
R2068:Bsn	UTSW	9	108126550	missense	possibly damaging	0.95
R2113:Bsn	UTSW	9	108114886	missense	probably benign	0.14
R2136:Bsn	UTSW	9	108113231	missense	probably damaging	1.00
R2266:Bsn	UTSW	9	108115124	missense	probably damaging	1.00
R2293:Bsn	UTSW	9	108113067	missense	possibly damaging	0.47
R2294:Bsn	UTSW	9	108113067	missense	possibly damaging	0.47
R2368:Bsn	UTSW	9	108111030	nonsense	probably null
R2442:Bsn	UTSW	9	108106920	missense	unknown
R2507:Bsn	UTSW	9	108116114	missense	probably damaging	1.00
R2880:Bsn	UTSW	9	108113067	missense	possibly damaging	0.47
R2881:Bsn	UTSW	9	108113067	missense	possibly damaging	0.47
R2922:Bsn	UTSW	9	108108186	missense	unknown
R2922:Bsn	UTSW	9	108115469	missense	probably damaging	1.00
R3618:Bsn	UTSW	9	108117561	critical splice acceptor site	probably null
R3742:Bsn	UTSW	9	108105739	missense	unknown
R3825:Bsn	UTSW	9	108106856	missense	unknown
R3982:Bsn	UTSW	9	108107166	missense	unknown
R4094:Bsn	UTSW	9	108113870	missense	probably damaging	1.00
R4158:Bsn	UTSW	9	108112946	missense	possibly damaging	0.95
R4225:Bsn	UTSW	9	108106733	missense	unknown
R4261:Bsn	UTSW	9	108110684	unclassified	probably benign
R4482:Bsn	UTSW	9	108114664	missense	probably damaging	1.00
R4515:Bsn	UTSW	9	108104078	splice site	probably null
R4585:Bsn	UTSW	9	108110463	unclassified	probably benign
R4628:Bsn	UTSW	9	108113235	missense	probably damaging	1.00
R4636:Bsn	UTSW	9	108115424	missense	probably damaging	1.00
R4679:Bsn	UTSW	9	108110130	missense	unknown
R4723:Bsn	UTSW	9	108112655	missense	probably benign	0.03
R4843:Bsn	UTSW	9	108107189	missense	unknown
R4885:Bsn	UTSW	9	108107527	nonsense	probably null
R4936:Bsn	UTSW	9	108111761	missense	probably damaging	1.00
R4942:Bsn	UTSW	9	108106479	missense	unknown
R4972:Bsn	UTSW	9	108115178	missense	probably damaging	1.00
R4992:Bsn	UTSW	9	108115548	missense	probably damaging	1.00
R5067:Bsn	UTSW	9	108111953	missense	probably damaging	1.00
R5206:Bsn	UTSW	9	108105373	missense	unknown
R5286:Bsn	UTSW	9	108110924	unclassified	probably benign
R5492:Bsn	UTSW	9	108112515	missense	probably damaging	0.98
R5553:Bsn	UTSW	9	108110421	unclassified	probably benign
R5561:Bsn	UTSW	9	108105511	missense	unknown
R5597:Bsn	UTSW	9	108114932	missense	probably benign	0.06
R5646:Bsn	UTSW	9	108110432	unclassified	probably benign
R5796:Bsn	UTSW	9	108126024	missense	probably damaging	1.00
R5801:Bsn	UTSW	9	108113009	missense	possibly damaging	0.81
R5802:Bsn	UTSW	9	108113009	missense	possibly damaging	0.81
R5850:Bsn	UTSW	9	108114950	missense	probably damaging	0.99
R5938:Bsn	UTSW	9	108113009	missense	possibly damaging	0.81
R6221:Bsn	UTSW	9	108105566	missense	unknown
R6243:Bsn	UTSW	9	108107561	missense	unknown
R6254:Bsn	UTSW	9	108111866	missense	probably damaging	0.96
R6263:Bsn	UTSW	9	108113254	missense	probably damaging	1.00
R6345:Bsn	UTSW	9	108107355	missense	unknown
R6368:Bsn	UTSW	9	108111314	unclassified	probably benign
R6574:Bsn	UTSW	9	108113954	missense	possibly damaging	0.95
R6793:Bsn	UTSW	9	108114615	nonsense	probably null
R6802:Bsn	UTSW	9	108110624	unclassified	probably benign
R6943:Bsn	UTSW	9	108107817	missense	unknown
R6999:Bsn	UTSW	9	108113433	missense	probably benign	0.00
R7149:Bsn	UTSW	9	108116321	nonsense	probably null
R7199:Bsn	UTSW	9	108115334	missense	probably damaging	1.00
R7322:Bsn	UTSW	9	108126421	nonsense	probably null
R7349:Bsn	UTSW	9	108110783	missense	unknown
R7372:Bsn	UTSW	9	108110519	missense	unknown
R7373:Bsn	UTSW	9	108113484	missense	probably damaging	1.00
R7413:Bsn	UTSW	9	108139491	missense	possibly damaging	0.61
R7473:Bsn	UTSW	9	108112250	missense	probably damaging	1.00
R7482:Bsn	UTSW	9	108113529	missense	probably damaging	0.98
R7530:Bsn	UTSW	9	108111956	missense	probably damaging	1.00
R7549:Bsn	UTSW	9	108114815	missense	probably benign	0.05
R7570:Bsn	UTSW	9	108113543	missense	probably damaging	1.00
R7635:Bsn	UTSW	9	108110990	missense	unknown
R7696:Bsn	UTSW	9	108114501	missense	probably damaging	1.00
R7757:Bsn	UTSW	9	108114740	missense	possibly damaging	0.90
R7868:Bsn	UTSW	9	108114899	missense	possibly damaging	0.95
R7897:Bsn	UTSW	9	108111866	missense	probably damaging	0.98
R7960:Bsn	UTSW	9	108115548	missense	probably damaging	1.00
R8022:Bsn	UTSW	9	108114404	missense	probably benign	0.01
R8056:Bsn	UTSW	9	108105307	missense
R8158:Bsn	UTSW	9	108110033	missense	unknown
R8161:Bsn	UTSW	9	108139530	missense	probably benign	0.20
R8225:Bsn	UTSW	9	108107106	missense
R8282:Bsn	UTSW	9	108107691	missense	possibly damaging	0.73
R8296:Bsn	UTSW	9	108117379	missense	probably benign	0.00
R8415:Bsn	UTSW	9	108111452	missense	probably benign	0.00
R8417:Bsn	UTSW	9	108111452	missense	probably benign	0.00
R8426:Bsn	UTSW	9	108126573	missense	probably damaging	1.00
R8437:Bsn	UTSW	9	108111452	missense	probably benign	0.00
R8438:Bsn	UTSW	9	108111452	missense	probably benign	0.00
R8439:Bsn	UTSW	9	108111452	missense	probably benign	0.00
R8440:Bsn	UTSW	9	108111452	missense	probably benign	0.00
R8441:Bsn	UTSW	9	108111452	missense	probably benign	0.00
R8442:Bsn	UTSW	9	108111452	missense	probably benign	0.00
R8513:Bsn	UTSW	9	108114510	missense	possibly damaging	0.65
R8529:Bsn	UTSW	9	108111452	missense	probably benign	0.00
R8535:Bsn	UTSW	9	108111452	missense	probably benign	0.00
R8546:Bsn	UTSW	9	108111452	missense	probably benign	0.00
R8548:Bsn	UTSW	9	108111452	missense	probably benign	0.00
R8549:Bsn	UTSW	9	108111452	missense	probably benign	0.00
R8682:Bsn	UTSW	9	108106169	missense
R8773:Bsn	UTSW	9	108110505	missense	unknown
R8883:Bsn	UTSW	9	108113028	missense	probably damaging	0.98
R8906:Bsn	UTSW	9	108107553	missense	unknown
R9018:Bsn	UTSW	9	108117289	missense	probably benign	0.06
R9070:Bsn	UTSW	9	108110096	missense
R9094:Bsn	UTSW	9	108110853	missense	unknown
R9098:Bsn	UTSW	9	108112974	missense	possibly damaging	0.65
R9128:Bsn	UTSW	9	108116150	missense	probably benign	0.21
R9162:Bsn	UTSW	9	108110684	missense	unknown
R9224:Bsn	UTSW	9	108105487	missense
R9230:Bsn	UTSW	9	108112260	missense	probably damaging	1.00
R9233:Bsn	UTSW	9	108117090	missense	probably benign	0.28
R9245:Bsn	UTSW	9	108116093	missense	probably damaging	1.00
R9275:Bsn	UTSW	9	108111620	missense	probably damaging	1.00
R9307:Bsn	UTSW	9	108115794	missense	probably benign	0.01
R9343:Bsn	UTSW	9	108115502	missense	probably damaging	1.00
R9377:Bsn	UTSW	9	108113601	missense	probably damaging	1.00
R9377:Bsn	UTSW	9	108116162	missense	probably damaging	1.00
R9378:Bsn	UTSW	9	108107655	missense	possibly damaging	0.85
R9408:Bsn	UTSW	9	108139453	nonsense	probably null
R9455:Bsn	UTSW	9	108111332	missense	unknown
R9563:Bsn	UTSW	9	108107417	missense
R9615:Bsn	UTSW	9	108107231	missense
R9656:Bsn	UTSW	9	108117208	missense	probably benign	0.09
R9698:Bsn	UTSW	9	108115971	missense	probably damaging	1.00
X0028:Bsn	UTSW	9	108113504	missense	probably damaging	1.00
X0066:Bsn	UTSW	9	108139210	missense	probably damaging	1.00
Z1177:Bsn	UTSW	9	108105499	missense
Z1177:Bsn	UTSW	9	108139195	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- GCTCTGTCAGACGTCCATTG -3'
(R):5'- TAAGTCTCCACAAGTGCTCTAC -3'

Sequencing Primer
(F):5'- CTTTGGAGCCAGAGGTGAC -3'
(R):5'- ACAAGTGCTCTACTCTCCAGTG -3'

Posted On

2014-10-02