Incidental Mutation 'R2172:Qars'
ID 237566
Institutional Source Beutler Lab
Gene Symbol Qars
Ensembl Gene ENSMUSG00000032604
Gene Name glutaminyl-tRNA synthetase
Synonyms 1110018N24Rik, 1200016L19Rik
MMRRC Submission 040174-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.965) question?
Stock # R2172 (G1)
Quality Score 225
Status Not validated
Chromosome 9
Chromosomal Location 108507706-108515941 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) C to T at 108509200 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Arginine to Cysteine at position 143 (R143C)
Ref Sequence ENSEMBL: ENSMUSP00000146941 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000006838] [ENSMUST00000134939] [ENSMUST00000194045] [ENSMUST00000207947] [ENSMUST00000207862] [ENSMUST00000208581] [ENSMUST00000207810] [ENSMUST00000208214] [ENSMUST00000208162] [ENSMUST00000208177] [ENSMUST00000207790]
AlphaFold Q8BML9
Predicted Effect possibly damaging
Transcript: ENSMUST00000006838
AA Change: R143C

PolyPhen 2 Score 0.910 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000006838
Gene: ENSMUSG00000032604
AA Change: R143C

DomainStartEndE-ValueType
Pfam:tRNA_synt_1c_R1 4 162 1.2e-54 PFAM
Pfam:tRNA_synt_1c_R2 165 256 6.5e-31 PFAM
Pfam:tRNA-synt_1c 263 563 4.5e-119 PFAM
Pfam:tRNA-synt_1c_C 565 752 6.9e-48 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000131005
Predicted Effect
SMART Domains Protein: ENSMUSP00000122918
Gene: ENSMUSG00000032604
AA Change: R143C

DomainStartEndE-ValueType
Pfam:tRNA_synt_1c_R1 1 163 1.1e-55 PFAM
Pfam:tRNA_synt_1c_R2 164 256 6.9e-31 PFAM
Pfam:tRNA-synt_1c 263 563 2.5e-115 PFAM
Pfam:tRNA-synt_1c_C 565 720 5.7e-35 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000137980
Predicted Effect noncoding transcript
Transcript: ENSMUST00000141201
Predicted Effect noncoding transcript
Transcript: ENSMUST00000141780
Predicted Effect probably benign
Transcript: ENSMUST00000141903
SMART Domains Protein: ENSMUSP00000121146
Gene: ENSMUSG00000032604

DomainStartEndE-ValueType
Pfam:tRNA-synt_1c 2 148 2.1e-50 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000144253
Predicted Effect noncoding transcript
Transcript: ENSMUST00000154311
Predicted Effect noncoding transcript
Transcript: ENSMUST00000154324
Predicted Effect noncoding transcript
Transcript: ENSMUST00000192627
Predicted Effect noncoding transcript
Transcript: ENSMUST00000192659
Predicted Effect probably benign
Transcript: ENSMUST00000194045
Predicted Effect noncoding transcript
Transcript: ENSMUST00000207062
Predicted Effect noncoding transcript
Transcript: ENSMUST00000207126
Predicted Effect probably damaging
Transcript: ENSMUST00000207947
AA Change: R143C

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
Predicted Effect
Predicted Effect probably benign
Transcript: ENSMUST00000207862
AA Change: R131C

PolyPhen 2 Score 0.192 (Sensitivity: 0.92; Specificity: 0.87)
Predicted Effect probably damaging
Transcript: ENSMUST00000208581
AA Change: R143C

PolyPhen 2 Score 0.989 (Sensitivity: 0.72; Specificity: 0.97)
Predicted Effect
Predicted Effect probably benign
Transcript: ENSMUST00000208074
Predicted Effect probably benign
Transcript: ENSMUST00000208214
Predicted Effect probably benign
Transcript: ENSMUST00000208506
Predicted Effect probably benign
Transcript: ENSMUST00000208162
Predicted Effect noncoding transcript
Transcript: ENSMUST00000208069
Predicted Effect probably benign
Transcript: ENSMUST00000208177
Predicted Effect noncoding transcript
Transcript: ENSMUST00000208102
Predicted Effect probably benign
Transcript: ENSMUST00000207790
Predicted Effect probably benign
Transcript: ENSMUST00000207734
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.4%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 64 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Arap3 T A 18: 37,990,560 E441V probably damaging Het
Arfip2 T A 7: 105,637,988 D64V probably damaging Het
Atg9a C A 1: 75,185,685 R527L probably damaging Het
Atp1a1 T G 3: 101,590,548 I308L probably benign Het
Bcan T A 3: 87,996,581 Y199F probably damaging Het
Bsn T C 9: 108,109,992 probably benign Het
Ccdc158 A T 5: 92,632,508 L902H probably damaging Het
Dnah7b A G 1: 46,124,512 Y492C probably benign Het
Dnah9 G T 11: 66,072,779 H1783N probably damaging Het
Dpep2 A G 8: 105,988,998 V320A possibly damaging Het
Dsc2 A G 18: 20,045,502 Y282H probably damaging Het
Egfr C T 11: 16,911,562 P1114S probably benign Het
Fastkd1 A G 2: 69,700,133 S560P probably damaging Het
Gm10696 T G 3: 94,176,298 K69Q possibly damaging Het
Gm14295 G A 2: 176,811,102 R795Q possibly damaging Het
Gpr155 C T 2: 73,382,127 V51I probably benign Het
Gsap G A 5: 21,222,440 probably null Het
Hecw1 T A 13: 14,377,706 I103F probably damaging Het
Herc3 T A 6: 58,887,437 N685K probably damaging Het
Hnrnph1 T A 11: 50,382,816 D244E probably benign Het
Hydin A G 8: 110,582,049 E3989G probably benign Het
Ibsp T C 5: 104,310,430 Y278H probably damaging Het
Ift57 T G 16: 49,759,340 N291K probably benign Het
Il15ra A G 2: 11,723,571 T149A possibly damaging Het
Ints5 C T 19: 8,896,282 T535I possibly damaging Het
Jarid2 T C 13: 44,902,539 L268P probably damaging Het
Klhdc7a T A 4: 139,965,810 T609S probably benign Het
Lrrc49 A G 9: 60,602,682 V429A probably benign Het
Lsm3 T C 6: 91,522,272 V87A possibly damaging Het
Man1c1 G C 4: 134,703,438 P11R probably damaging Het
Map1a G T 2: 121,307,932 V2726L probably damaging Het
Marveld3 A C 8: 109,961,846 S88A probably benign Het
Mcm9 T C 10: 53,548,574 D640G probably damaging Het
Mettl4 A G 17: 94,733,163 I399T probably benign Het
Mmp27 T A 9: 7,577,378 L274* probably null Het
Nacc2 A C 2: 26,060,223 D500E probably benign Het
Nprl3 T A 11: 32,234,894 M372L probably benign Het
Olfr478 A T 7: 108,031,467 I292N probably damaging Het
Otud7b T G 3: 96,153,520 probably null Het
Pcx G A 19: 4,620,881 R1070H probably benign Het
Ptprq C T 10: 107,590,994 W1560* probably null Het
Puf60 A T 15: 76,070,464 I520N probably damaging Het
Rfx3 G A 19: 27,815,494 Q322* probably null Het
Samd14 G T 11: 95,014,391 V10L probably benign Het
Setd2 G A 9: 110,549,844 R909Q probably benign Het
Sh2d4a T C 8: 68,296,664 S117P probably benign Het
Sharpin C A 15: 76,350,666 probably benign Het
Skor1 C A 9: 63,145,122 A494S possibly damaging Het
Slc41a2 T C 10: 83,283,774 T375A probably benign Het
Sparc G A 11: 55,395,801 Q324* probably null Het
Srebf1 T C 11: 60,206,502 T171A probably benign Het
Srrd A G 5: 112,341,122 I54T possibly damaging Het
Tecpr1 G T 5: 144,196,417 Q1072K probably damaging Het
Tecpr1 A T 5: 144,211,456 V377E probably benign Het
Tln1 T A 4: 43,545,721 H919L probably benign Het
Tm9sf3 C T 19: 41,217,420 S516N probably damaging Het
Trpa1 T A 1: 14,881,656 T940S probably benign Het
Trpv4 G A 5: 114,644,710 R64C probably damaging Het
Tufm A G 7: 126,488,847 E174G probably benign Het
Urb2 A G 8: 124,031,102 T1183A probably damaging Het
Virma A T 4: 11,527,843 M1245L possibly damaging Het
Vmn2r32 T C 7: 7,474,615 Y259C probably damaging Het
Zfp329 A G 7: 12,810,767 F277L probably damaging Het
Zfp683 C T 4: 134,055,795 T190I possibly damaging Het
Other mutations in Qars
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01570:Qars APN 9 108511539 missense probably damaging 1.00
IGL02336:Qars APN 9 108514986 nonsense probably null
IGL02393:Qars APN 9 108514329 missense probably benign 0.00
IGL03102:Qars APN 9 108508919 missense probably benign 0.35
R0576:Qars UTSW 9 108514962 intron probably benign
R1777:Qars UTSW 9 108508201 critical splice donor site probably null
R1824:Qars UTSW 9 108514610 missense probably damaging 1.00
R1871:Qars UTSW 9 108514116 splice site probably null
R1897:Qars UTSW 9 108514083 nonsense probably null
R1952:Qars UTSW 9 108513181 missense probably benign 0.35
R1981:Qars UTSW 9 108515028 missense probably damaging 1.00
R2698:Qars UTSW 9 108508443 missense possibly damaging 0.65
R4381:Qars UTSW 9 108510183 unclassified probably benign
R4608:Qars UTSW 9 108509426 splice site probably null
R4677:Qars UTSW 9 108509690 unclassified probably benign
R4974:Qars UTSW 9 108508931 missense probably damaging 1.00
R5234:Qars UTSW 9 108514165 missense probably damaging 1.00
R5548:Qars UTSW 9 108512918 missense possibly damaging 0.72
R5817:Qars UTSW 9 108510242 unclassified probably benign
R6029:Qars UTSW 9 108513690 missense probably damaging 1.00
R6110:Qars UTSW 9 108508098 missense probably benign 0.02
R6889:Qars UTSW 9 108513183 missense probably damaging 0.98
R7034:Qars UTSW 9 108514777 missense probably damaging 1.00
R7036:Qars UTSW 9 108514777 missense probably damaging 1.00
R7136:Qars UTSW 9 108512772 missense probably damaging 1.00
R7178:Qars UTSW 9 108515123 missense possibly damaging 0.50
R7192:Qars UTSW 9 108511561 missense probably damaging 1.00
R7235:Qars UTSW 9 108510132 missense probably damaging 1.00
R7813:Qars UTSW 9 108509471 missense probably damaging 1.00
R8248:Qars UTSW 9 108509452 missense probably benign 0.00
R8558:Qars UTSW 9 108515223 missense probably benign
R9126:Qars UTSW 9 108509200 missense probably damaging 1.00
R9245:Qars UTSW 9 108508933 nonsense probably null
Predicted Primers PCR Primer
(F):5'- GGAAGCTGTAAGTCCTCTCC -3'
(R):5'- TCAAAGAAGGCCCAGCTGAC -3'

Sequencing Primer
(F):5'- AGGCATCAGATATCTCCTCCTAG -3'
(R):5'- AGCTGACTCAGGACCAGGAC -3'
Posted On 2014-10-02