Mutagenetix > Incidental Mutations

Incidental Mutation 'R2172:Setd2'

237567

Institutional Source

Beutler Lab

Gene Symbol

Setd2

Ensembl Gene

ENSMUSG00000044791

Gene Name

SET domain containing 2

Synonyms

4921524K10Rik, KMT3A

MMRRC Submission

040174-MU

Accession Numbers

Is this an essential gene?

Probably essential (E-score: 0.936) question?

Stock #

R2172 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

110532597-110618633 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

G to A at 110549844 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Arginine to Glutamine at position 909 (R909Q)

Ref Sequence

ENSEMBL: ENSMUSP00000116313 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000153838]

AlphaFold

E9Q5F9

Predicted Effect

probably benign
Transcript: ENSMUST00000153838
AA Change: R909Q

PolyPhen 2 Score 0.101 (Sensitivity: 0.93; Specificity: 0.86)

SMART Domains

Protein: ENSMUSP00000116313
Gene: ENSMUSG00000044791
AA Change: R909Q

Domain	Start	End	E-Value	Type
low complexity region	19	34	N/A	INTRINSIC
low complexity region	156	176	N/A	INTRINSIC
low complexity region	185	207	N/A	INTRINSIC
low complexity region	297	313	N/A	INTRINSIC
low complexity region	392	419	N/A	INTRINSIC
low complexity region	795	809	N/A	INTRINSIC
low complexity region	867	883	N/A	INTRINSIC
low complexity region	1015	1039	N/A	INTRINSIC
low complexity region	1066	1077	N/A	INTRINSIC
low complexity region	1384	1395	N/A	INTRINSIC
AWS	1468	1523	8.39e-30	SMART
SET	1524	1647	3.07e-41	SMART
PostSET	1648	1664	1.27e-5	SMART
Blast:SET	1689	1714	2e-6	BLAST
low complexity region	1884	1909	N/A	INTRINSIC
low complexity region	1956	1967	N/A	INTRINSIC
coiled coil region	2090	2113	N/A	INTRINSIC
low complexity region	2189	2211	N/A	INTRINSIC
low complexity region	2248	2265	N/A	INTRINSIC
WW	2363	2395	2.1e-11	SMART
Pfam:SRI	2440	2530	6e-30	PFAM

Predicted Effect

unknown
Transcript: ENSMUST00000196814
AA Change: R625Q

Predicted Effect

probably benign
Transcript: ENSMUST00000198823

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000199595

Coding Region Coverage

1x: 99.2%
3x: 98.7%
10x: 97.4%
20x: 95.4%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Huntington's disease (HD), a neurodegenerative disorder characterized by loss of striatal neurons, is caused by an expansion of a polyglutamine tract in the HD protein huntingtin. This gene encodes a protein belonging to a class of huntingtin interacting proteins characterized by WW motifs. This protein is a histone methyltransferase that is specific for lysine-36 of histone H3, and methylation of this residue is associated with active chromatin. This protein also contains a novel transcriptional activation domain and has been found associated with hyperphosphorylated RNA polymerase II. [provided by RefSeq, Aug 2008]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit impaired embryonic vascular remodeling in the embryo proper, yolk sac, and placenta that leads to death around E10.5. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 64 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Arap3	T	A	18: 37,990,560	E441V	probably damaging	Het
Arfip2	T	A	7: 105,637,988	D64V	probably damaging	Het
Atg9a	C	A	1: 75,185,685	R527L	probably damaging	Het
Atp1a1	T	G	3: 101,590,548	I308L	probably benign	Het
Bcan	T	A	3: 87,996,581	Y199F	probably damaging	Het
Bsn	T	C	9: 108,109,992		probably benign	Het
Ccdc158	A	T	5: 92,632,508	L902H	probably damaging	Het
Dnah7b	A	G	1: 46,124,512	Y492C	probably benign	Het
Dnah9	G	T	11: 66,072,779	H1783N	probably damaging	Het
Dpep2	A	G	8: 105,988,998	V320A	possibly damaging	Het
Dsc2	A	G	18: 20,045,502	Y282H	probably damaging	Het
Egfr	C	T	11: 16,911,562	P1114S	probably benign	Het
Fastkd1	A	G	2: 69,700,133	S560P	probably damaging	Het
Gm10696	T	G	3: 94,176,298	K69Q	possibly damaging	Het
Gm14295	G	A	2: 176,811,102	R795Q	possibly damaging	Het
Gpr155	C	T	2: 73,382,127	V51I	probably benign	Het
Gsap	G	A	5: 21,222,440		probably null	Het
Hecw1	T	A	13: 14,377,706	I103F	probably damaging	Het
Herc3	T	A	6: 58,887,437	N685K	probably damaging	Het
Hnrnph1	T	A	11: 50,382,816	D244E	probably benign	Het
Hydin	A	G	8: 110,582,049	E3989G	probably benign	Het
Ibsp	T	C	5: 104,310,430	Y278H	probably damaging	Het
Ift57	T	G	16: 49,759,340	N291K	probably benign	Het
Il15ra	A	G	2: 11,723,571	T149A	possibly damaging	Het
Ints5	C	T	19: 8,896,282	T535I	possibly damaging	Het
Jarid2	T	C	13: 44,902,539	L268P	probably damaging	Het
Klhdc7a	T	A	4: 139,965,810	T609S	probably benign	Het
Lrrc49	A	G	9: 60,602,682	V429A	probably benign	Het
Lsm3	T	C	6: 91,522,272	V87A	possibly damaging	Het
Man1c1	G	C	4: 134,703,438	P11R	probably damaging	Het
Map1a	G	T	2: 121,307,932	V2726L	probably damaging	Het
Marveld3	A	C	8: 109,961,846	S88A	probably benign	Het
Mcm9	T	C	10: 53,548,574	D640G	probably damaging	Het
Mettl4	A	G	17: 94,733,163	I399T	probably benign	Het
Mmp27	T	A	9: 7,577,378	L274*	probably null	Het
Nacc2	A	C	2: 26,060,223	D500E	probably benign	Het
Nprl3	T	A	11: 32,234,894	M372L	probably benign	Het
Olfr478	A	T	7: 108,031,467	I292N	probably damaging	Het
Otud7b	T	G	3: 96,153,520		probably null	Het
Pcx	G	A	19: 4,620,881	R1070H	probably benign	Het
Ptprq	C	T	10: 107,590,994	W1560*	probably null	Het
Puf60	A	T	15: 76,070,464	I520N	probably damaging	Het
Qars	C	T	9: 108,509,200	R143C	probably damaging	Het
Rfx3	G	A	19: 27,815,494	Q322*	probably null	Het
Samd14	G	T	11: 95,014,391	V10L	probably benign	Het
Sh2d4a	T	C	8: 68,296,664	S117P	probably benign	Het
Sharpin	C	A	15: 76,350,666		probably benign	Het
Skor1	C	A	9: 63,145,122	A494S	possibly damaging	Het
Slc41a2	T	C	10: 83,283,774	T375A	probably benign	Het
Sparc	G	A	11: 55,395,801	Q324*	probably null	Het
Srebf1	T	C	11: 60,206,502	T171A	probably benign	Het
Srrd	A	G	5: 112,341,122	I54T	possibly damaging	Het
Tecpr1	G	T	5: 144,196,417	Q1072K	probably damaging	Het
Tecpr1	A	T	5: 144,211,456	V377E	probably benign	Het
Tln1	T	A	4: 43,545,721	H919L	probably benign	Het
Tm9sf3	C	T	19: 41,217,420	S516N	probably damaging	Het
Trpa1	T	A	1: 14,881,656	T940S	probably benign	Het
Trpv4	G	A	5: 114,644,710	R64C	probably damaging	Het
Tufm	A	G	7: 126,488,847	E174G	probably benign	Het
Urb2	A	G	8: 124,031,102	T1183A	probably damaging	Het
Virma	A	T	4: 11,527,843	M1245L	possibly damaging	Het
Vmn2r32	T	C	7: 7,474,615	Y259C	probably damaging	Het
Zfp329	A	G	7: 12,810,767	F277L	probably damaging	Het
Zfp683	C	T	4: 134,055,795	T190I	possibly damaging	Het

Other mutations in Setd2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00722:Setd2	APN	9	110551136	missense	possibly damaging	0.94
IGL01023:Setd2	APN	9	110547513	nonsense	probably null
IGL01063:Setd2	APN	9	110573673	missense	probably damaging	1.00
IGL01745:Setd2	APN	9	110594711	missense	probably damaging	0.99
IGL01911:Setd2	APN	9	110617431	splice site	probably null
IGL01955:Setd2	APN	9	110549318	missense	probably benign	0.38
IGL02023:Setd2	APN	9	110594636	missense	probably benign	0.06
IGL02080:Setd2	APN	9	110547450	splice site	probably null
IGL02412:Setd2	APN	9	110550774	missense	probably benign	0.00
IGL02519:Setd2	APN	9	110553116	missense	probably damaging	0.97
IGL02631:Setd2	APN	9	110550576	missense	possibly damaging	0.80
IGL02754:Setd2	APN	9	110550056	missense	possibly damaging	0.77
IGL02828:Setd2	APN	9	110561214	missense	probably benign	0.31
IGL03033:Setd2	APN	9	110551275	missense	possibly damaging	0.96
IGL03140:Setd2	APN	9	110614952	critical splice donor site	probably null
IGL03378:Setd2	APN	9	110553152	missense	unknown
American_samoa	UTSW	9	110567758	nonsense	probably null
slingshot	UTSW	9	110549507	missense	probably benign	0.00
P0028:Setd2	UTSW	9	110573954	missense	probably benign	0.00
PIT4544001:Setd2	UTSW	9	110551164	missense	probably damaging	1.00
R0058:Setd2	UTSW	9	110594426	missense	probably damaging	0.98
R0058:Setd2	UTSW	9	110594426	missense	probably damaging	0.98
R0167:Setd2	UTSW	9	110573782	missense	probably damaging	1.00
R0408:Setd2	UTSW	9	110594242	missense	probably damaging	1.00
R0452:Setd2	UTSW	9	110553100	splice site	probably null
R0541:Setd2	UTSW	9	110573673	missense	probably damaging	1.00
R0947:Setd2	UTSW	9	110548511	missense	possibly damaging	0.87
R1249:Setd2	UTSW	9	110573880	missense	probably damaging	0.99
R1294:Setd2	UTSW	9	110549507	missense	probably benign	0.00
R1518:Setd2	UTSW	9	110602238	missense	probably damaging	0.98
R1585:Setd2	UTSW	9	110551396	missense	unknown
R1647:Setd2	UTSW	9	110549864	missense	probably benign	0.12
R1649:Setd2	UTSW	9	110549864	missense	probably benign	0.12
R1651:Setd2	UTSW	9	110549864	missense	probably benign	0.12
R1652:Setd2	UTSW	9	110549864	missense	probably benign	0.12
R1673:Setd2	UTSW	9	110604180	missense	probably damaging	0.97
R1703:Setd2	UTSW	9	110549864	missense	probably benign	0.12
R1706:Setd2	UTSW	9	110549864	missense	probably benign	0.12
R1709:Setd2	UTSW	9	110549857	missense	probably benign	0.00
R1752:Setd2	UTSW	9	110594605	missense	probably damaging	1.00
R1796:Setd2	UTSW	9	110550345	missense	probably benign	0.01
R1796:Setd2	UTSW	9	110617816	critical splice acceptor site	probably null
R1812:Setd2	UTSW	9	110550102	missense	probably damaging	0.99
R1884:Setd2	UTSW	9	110556418	critical splice donor site	probably null
R2024:Setd2	UTSW	9	110549133	missense	possibly damaging	0.65
R2051:Setd2	UTSW	9	110550890	missense	probably benign
R2117:Setd2	UTSW	9	110604144	frame shift	probably null
R2120:Setd2	UTSW	9	110549864	missense	probably benign	0.12
R2124:Setd2	UTSW	9	110549864	missense	probably benign	0.12
R2179:Setd2	UTSW	9	110594688	nonsense	probably null
R2262:Setd2	UTSW	9	110561243	intron	probably benign
R2411:Setd2	UTSW	9	110550429	missense	possibly damaging	0.46
R2413:Setd2	UTSW	9	110547504	missense	probably damaging	1.00
R2419:Setd2	UTSW	9	110548997	missense	possibly damaging	0.48
R2424:Setd2	UTSW	9	110617522	missense	probably benign	0.37
R3757:Setd2	UTSW	9	110573685	missense	probably damaging	0.99
R3765:Setd2	UTSW	9	110594246	missense	probably damaging	1.00
R3796:Setd2	UTSW	9	110549571	missense	probably benign	0.00
R3797:Setd2	UTSW	9	110549571	missense	probably benign	0.00
R3799:Setd2	UTSW	9	110549571	missense	probably benign	0.00
R3899:Setd2	UTSW	9	110592518	missense	probably damaging	1.00
R3900:Setd2	UTSW	9	110592518	missense	probably damaging	1.00
R3913:Setd2	UTSW	9	110551046	missense	probably damaging	0.99
R4010:Setd2	UTSW	9	110599195	missense	probably null	1.00
R4580:Setd2	UTSW	9	110574243	missense	probably benign	0.06
R4614:Setd2	UTSW	9	110569813	critical splice donor site	probably null
R4651:Setd2	UTSW	9	110594132	missense	possibly damaging	0.53
R4652:Setd2	UTSW	9	110594132	missense	possibly damaging	0.53
R4855:Setd2	UTSW	9	110571954	missense	probably benign	0.02
R4970:Setd2	UTSW	9	110548158	missense	probably benign	0.28
R5112:Setd2	UTSW	9	110548158	missense	probably benign	0.28
R5123:Setd2	UTSW	9	110617527	missense	possibly damaging	0.76
R5140:Setd2	UTSW	9	110551129	missense	probably benign	0.00
R5202:Setd2	UTSW	9	110551230	missense	probably damaging	1.00
R5290:Setd2	UTSW	9	110617831	missense	probably damaging	1.00
R5560:Setd2	UTSW	9	110549839	nonsense	probably null
R5604:Setd2	UTSW	9	110604216	missense	probably damaging	0.99
R5678:Setd2	UTSW	9	110602186	missense	probably damaging	0.99
R5708:Setd2	UTSW	9	110548823	missense	possibly damaging	0.59
R5763:Setd2	UTSW	9	110556275	splice site	probably null
R5814:Setd2	UTSW	9	110567758	nonsense	probably null
R5924:Setd2	UTSW	9	110574044	missense	probably benign	0.23
R6244:Setd2	UTSW	9	110548665	missense	probably damaging	1.00
R6313:Setd2	UTSW	9	110556366	missense	unknown
R6431:Setd2	UTSW	9	110550385	missense	possibly damaging	0.65
R6526:Setd2	UTSW	9	110532717	missense	probably benign	0.33
R6579:Setd2	UTSW	9	110549778	missense	possibly damaging	0.87
R6996:Setd2	UTSW	9	110550572	missense	probably damaging	0.99
R7012:Setd2	UTSW	9	110547683	missense	probably damaging	0.97
R7105:Setd2	UTSW	9	110548260	missense	probably damaging	1.00
R7134:Setd2	UTSW	9	110548797	missense	possibly damaging	0.87
R7222:Setd2	UTSW	9	110551462	missense
R7359:Setd2	UTSW	9	110562944	missense
R7492:Setd2	UTSW	9	110594632	missense
R7643:Setd2	UTSW	9	110567840	splice site	probably null
R7869:Setd2	UTSW	9	110550014	nonsense	probably null
R7903:Setd2	UTSW	9	110617837	missense
R8004:Setd2	UTSW	9	110592545	missense
R8017:Setd2	UTSW	9	110602187	missense
R8019:Setd2	UTSW	9	110602187	missense
R8366:Setd2	UTSW	9	110548748	missense	probably damaging	1.00
R8460:Setd2	UTSW	9	110594270	missense
R8498:Setd2	UTSW	9	110549921	missense	probably damaging	0.99
R8725:Setd2	UTSW	9	110573844	missense
R8870:Setd2	UTSW	9	110594253	missense
R8878:Setd2	UTSW	9	110592399	missense	probably benign
R9132:Setd2	UTSW	9	110545317	critical splice donor site	probably null
R9159:Setd2	UTSW	9	110545317	critical splice donor site	probably null
R9198:Setd2	UTSW	9	110549100	missense	possibly damaging	0.77
R9277:Setd2	UTSW	9	110550551	missense	probably damaging	1.00
R9326:Setd2	UTSW	9	110549603	missense	probably benign	0.00
RF009:Setd2	UTSW	9	110550711	missense	probably damaging	1.00
Z1176:Setd2	UTSW	9	110532726	missense	possibly damaging	0.85
Z1176:Setd2	UTSW	9	110547275	missense	probably damaging	0.99
Z1176:Setd2	UTSW	9	110547579	missense	probably damaging	0.97
Z1177:Setd2	UTSW	9	110547476	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- TAATAGGGAGCCGACAGACC -3'
(R):5'- TTTGTTCCTCATCTAAGGGGATTTC -3'

Sequencing Primer
(F):5'- CAGAGCATTGGTAGCACTAGTTC -3'
(R):5'- CCTCATCTAAGGGGATTTCTGGTC -3'

Posted On

2014-10-02