Mutagenetix > Incidental Mutations

Incidental Mutation 'R2172:Egfr'

237572

Institutional Source

Beutler Lab

Gene Symbol

Egfr

Ensembl Gene

ENSMUSG00000020122

Gene Name

epidermal growth factor receptor

Synonyms

avian erythroblastic leukemia viral (v-erb-b) oncogene homolog, Wa5, 9030024J15Rik, Erbb, Errb1

MMRRC Submission

040174-MU

Accession Numbers

Is this an essential gene?

Probably essential (E-score: 0.907) question?

Stock #

R2172 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

16752203-16918158 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

C to T at 16911562 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Proline to Serine at position 1114 (P1114S)

Ref Sequence

ENSEMBL: ENSMUSP00000020329 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000020329]

AlphaFold

Q01279

Predicted Effect

probably benign
Transcript: ENSMUST00000020329
AA Change: P1114S

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)

SMART Domains

Protein: ENSMUSP00000020329
Gene: ENSMUSG00000020122
AA Change: P1114S

Domain	Start	End	E-Value	Type
low complexity region	5	25	N/A	INTRINSIC
Pfam:Recep_L_domain	57	168	1.4e-32	PFAM
low complexity region	182	195	N/A	INTRINSIC
FU	228	270	6.07e-4	SMART
Pfam:Recep_L_domain	361	481	1.8e-29	PFAM
FU	496	547	8.25e-6	SMART
FU	552	601	4.38e-10	SMART
FU	614	654	4.05e1	SMART
low complexity region	677	694	N/A	INTRINSIC
TyrKc	714	970	2.88e-129	SMART
low complexity region	1004	1017	N/A	INTRINSIC
low complexity region	1027	1048	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000138518

Coding Region Coverage

1x: 99.2%
3x: 98.7%
10x: 97.4%
20x: 95.4%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a transmembrane glycoprotein that is a member of the protein kinase superfamily. This protein is a receptor for members of the epidermal growth factor family. EGFR is a cell surface protein that binds to epidermal growth factor. Binding of the protein to a ligand induces receptor dimerization and tyrosine autophosphorylation and leads to cell proliferation. Mutations in this gene are associated with lung cancer. [provided by RefSeq, Jun 2016]
PHENOTYPE: Mutations widely affect epithelial development. Null homozygote survival is strain dependent, with defects observed in skin, eye, brain, viscera, palate, tongue and other tisses. Other mutations produce an open eyed, curly whisker phenotype, while a dominant hypermorph yields a thickened epidermis. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 64 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Arap3	T	A	18: 37,990,560	E441V	probably damaging	Het
Arfip2	T	A	7: 105,637,988	D64V	probably damaging	Het
Atg9a	C	A	1: 75,185,685	R527L	probably damaging	Het
Atp1a1	T	G	3: 101,590,548	I308L	probably benign	Het
Bcan	T	A	3: 87,996,581	Y199F	probably damaging	Het
Bsn	T	C	9: 108,109,992		probably benign	Het
Ccdc158	A	T	5: 92,632,508	L902H	probably damaging	Het
Dnah7b	A	G	1: 46,124,512	Y492C	probably benign	Het
Dnah9	G	T	11: 66,072,779	H1783N	probably damaging	Het
Dpep2	A	G	8: 105,988,998	V320A	possibly damaging	Het
Dsc2	A	G	18: 20,045,502	Y282H	probably damaging	Het
Fastkd1	A	G	2: 69,700,133	S560P	probably damaging	Het
Gm10696	T	G	3: 94,176,298	K69Q	possibly damaging	Het
Gm14295	G	A	2: 176,811,102	R795Q	possibly damaging	Het
Gpr155	C	T	2: 73,382,127	V51I	probably benign	Het
Gsap	G	A	5: 21,222,440		probably null	Het
Hecw1	T	A	13: 14,377,706	I103F	probably damaging	Het
Herc3	T	A	6: 58,887,437	N685K	probably damaging	Het
Hnrnph1	T	A	11: 50,382,816	D244E	probably benign	Het
Hydin	A	G	8: 110,582,049	E3989G	probably benign	Het
Ibsp	T	C	5: 104,310,430	Y278H	probably damaging	Het
Ift57	T	G	16: 49,759,340	N291K	probably benign	Het
Il15ra	A	G	2: 11,723,571	T149A	possibly damaging	Het
Ints5	C	T	19: 8,896,282	T535I	possibly damaging	Het
Jarid2	T	C	13: 44,902,539	L268P	probably damaging	Het
Klhdc7a	T	A	4: 139,965,810	T609S	probably benign	Het
Lrrc49	A	G	9: 60,602,682	V429A	probably benign	Het
Lsm3	T	C	6: 91,522,272	V87A	possibly damaging	Het
Man1c1	G	C	4: 134,703,438	P11R	probably damaging	Het
Map1a	G	T	2: 121,307,932	V2726L	probably damaging	Het
Marveld3	A	C	8: 109,961,846	S88A	probably benign	Het
Mcm9	T	C	10: 53,548,574	D640G	probably damaging	Het
Mettl4	A	G	17: 94,733,163	I399T	probably benign	Het
Mmp27	T	A	9: 7,577,378	L274*	probably null	Het
Nacc2	A	C	2: 26,060,223	D500E	probably benign	Het
Nprl3	T	A	11: 32,234,894	M372L	probably benign	Het
Olfr478	A	T	7: 108,031,467	I292N	probably damaging	Het
Otud7b	T	G	3: 96,153,520		probably null	Het
Pcx	G	A	19: 4,620,881	R1070H	probably benign	Het
Ptprq	C	T	10: 107,590,994	W1560*	probably null	Het
Puf60	A	T	15: 76,070,464	I520N	probably damaging	Het
Qars	C	T	9: 108,509,200	R143C	probably damaging	Het
Rfx3	G	A	19: 27,815,494	Q322*	probably null	Het
Samd14	G	T	11: 95,014,391	V10L	probably benign	Het
Setd2	G	A	9: 110,549,844	R909Q	probably benign	Het
Sh2d4a	T	C	8: 68,296,664	S117P	probably benign	Het
Sharpin	C	A	15: 76,350,666		probably benign	Het
Skor1	C	A	9: 63,145,122	A494S	possibly damaging	Het
Slc41a2	T	C	10: 83,283,774	T375A	probably benign	Het
Sparc	G	A	11: 55,395,801	Q324*	probably null	Het
Srebf1	T	C	11: 60,206,502	T171A	probably benign	Het
Srrd	A	G	5: 112,341,122	I54T	possibly damaging	Het
Tecpr1	G	T	5: 144,196,417	Q1072K	probably damaging	Het
Tecpr1	A	T	5: 144,211,456	V377E	probably benign	Het
Tln1	T	A	4: 43,545,721	H919L	probably benign	Het
Tm9sf3	C	T	19: 41,217,420	S516N	probably damaging	Het
Trpa1	T	A	1: 14,881,656	T940S	probably benign	Het
Trpv4	G	A	5: 114,644,710	R64C	probably damaging	Het
Tufm	A	G	7: 126,488,847	E174G	probably benign	Het
Urb2	A	G	8: 124,031,102	T1183A	probably damaging	Het
Virma	A	T	4: 11,527,843	M1245L	possibly damaging	Het
Vmn2r32	T	C	7: 7,474,615	Y259C	probably damaging	Het
Zfp329	A	G	7: 12,810,767	F277L	probably damaging	Het
Zfp683	C	T	4: 134,055,795	T190I	possibly damaging	Het

Other mutations in Egfr

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01338:Egfr	APN	11	16863020	missense	probably damaging	1.00
IGL01529:Egfr	APN	11	16863014	missense	probably benign
IGL01556:Egfr	APN	11	16905382	missense	probably damaging	1.00
IGL02627:Egfr	APN	11	16869346	missense	probably damaging	1.00
IGL02862:Egfr	APN	11	16883562	missense	probably benign	0.25
IGL02945:Egfr	APN	11	16752514	missense	probably damaging	1.00
IGL02994:Egfr	APN	11	16911811	missense	probably damaging	1.00
IGL03395:Egfr	APN	11	16910261	splice site	probably benign
set	UTSW	11	16871881	splice site	probably benign
Velvet	UTSW	11	16904399	missense	probably damaging	1.00
PIT1430001:Egfr	UTSW	11	16910214	missense	probably benign	0.00
R0196:Egfr	UTSW	11	16911746	missense	probably benign	0.02
R0513:Egfr	UTSW	11	16872855	missense	probably damaging	1.00
R0567:Egfr	UTSW	11	16872873	missense	probably benign	0.01
R0629:Egfr	UTSW	11	16869333	missense	probably damaging	1.00
R0961:Egfr	UTSW	11	16862964	missense	probably damaging	1.00
R1163:Egfr	UTSW	11	16883546	missense	probably benign	0.02
R1454:Egfr	UTSW	11	16889920	missense	probably benign
R1456:Egfr	UTSW	11	16863065	missense	probably benign	0.00
R1503:Egfr	UTSW	11	16869301	missense	possibly damaging	0.86
R1577:Egfr	UTSW	11	16869241	missense	probably benign	0.04
R1595:Egfr	UTSW	11	16906847	missense	probably damaging	0.99
R1699:Egfr	UTSW	11	16859019	missense	probably benign	0.14
R3690:Egfr	UTSW	11	16871881	splice site	probably benign
R3922:Egfr	UTSW	11	16881495	missense	probably damaging	1.00
R4444:Egfr	UTSW	11	16871027	missense	probably benign	0.00
R4685:Egfr	UTSW	11	16858980	missense	probably damaging	1.00
R4737:Egfr	UTSW	11	16869231	missense	probably damaging	0.99
R4814:Egfr	UTSW	11	16869354	missense	probably damaging	1.00
R4841:Egfr	UTSW	11	16911607	missense	probably benign	0.05
R4842:Egfr	UTSW	11	16911607	missense	probably benign	0.05
R4903:Egfr	UTSW	11	16908949	missense	probably damaging	1.00
R4964:Egfr	UTSW	11	16908949	missense	probably damaging	1.00
R4985:Egfr	UTSW	11	16859029	nonsense	probably null
R4998:Egfr	UTSW	11	16881493	missense	possibly damaging	0.58
R5001:Egfr	UTSW	11	16904434	missense	probably damaging	0.98
R5304:Egfr	UTSW	11	16884260	missense	probably benign
R5309:Egfr	UTSW	11	16911703	missense	probably benign	0.00
R5653:Egfr	UTSW	11	16911617	missense	probably benign	0.04
R5905:Egfr	UTSW	11	16911494	missense	probably damaging	1.00
R6051:Egfr	UTSW	11	16883607	missense	possibly damaging	0.87
R6052:Egfr	UTSW	11	16911554	missense	probably benign	0.16
R6114:Egfr	UTSW	11	16904374	missense	possibly damaging	0.46
R6261:Egfr	UTSW	11	16889964	missense	probably benign	0.11
R6434:Egfr	UTSW	11	16869294	missense	probably benign	0.25
R6475:Egfr	UTSW	11	16891259	missense	probably benign
R6799:Egfr	UTSW	11	16896952	missense	probably damaging	1.00
R7143:Egfr	UTSW	11	16871627	missense	probably benign	0.20
R7195:Egfr	UTSW	11	16868162	missense	probably damaging	1.00
R7459:Egfr	UTSW	11	16896967	missense	probably damaging	1.00
R7612:Egfr	UTSW	11	16859025	missense	possibly damaging	0.74
R7757:Egfr	UTSW	11	16889966	missense	possibly damaging	0.64
R7763:Egfr	UTSW	11	16891266	missense	probably damaging	1.00
R8315:Egfr	UTSW	11	16875027	missense	probably benign	0.08
R8320:Egfr	UTSW	11	16891251	missense	probably damaging	1.00
R8324:Egfr	UTSW	11	16858971	missense	probably damaging	0.99
R8324:Egfr	UTSW	11	16908885	missense	probably damaging	0.98
R8347:Egfr	UTSW	11	16878174	missense	probably damaging	1.00
R8440:Egfr	UTSW	11	16909831	missense	probably damaging	1.00
R8511:Egfr	UTSW	11	16896949	missense	probably damaging	1.00
R8708:Egfr	UTSW	11	16867300	critical splice donor site	probably benign
R8804:Egfr	UTSW	11	16869339	missense	probably benign	0.09
R8853:Egfr	UTSW	11	16908885	missense	possibly damaging	0.93
R8906:Egfr	UTSW	11	16911635	missense	probably damaging	1.00
R9177:Egfr	UTSW	11	16905410	missense	probably damaging	1.00
R9268:Egfr	UTSW	11	16905410	missense	probably damaging	1.00
R9335:Egfr	UTSW	11	16870991	missense	probably damaging	1.00
R9417:Egfr	UTSW	11	16875067	nonsense	probably null
R9454:Egfr	UTSW	11	16887155	missense	probably damaging	1.00
Z1177:Egfr	UTSW	11	16862954	missense	probably benign	0.05
Z1177:Egfr	UTSW	11	16869319	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- TTGCTGAGGACACTTGCAGG -3'
(R):5'- GGGCCCTTAAATATGCCATTTG -3'

Sequencing Primer
(F):5'- AGGACACTTGCAGGGCTTG -3'
(R):5'- AGAAGTCCTGCTGGTAGTCAG -3'

Posted On

2014-10-02