Incidental Mutation 'R2172:Nprl3'
ID 237573
Institutional Source Beutler Lab
Gene Symbol Nprl3
Ensembl Gene ENSMUSG00000020289
Gene Name nitrogen permease regulator-like 3
Synonyms Mare, HS-26, Prox1, Phg, -14 gene, HS-40, m(alpha)RE
MMRRC Submission 040174-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.224) question?
Stock # R2172 (G1)
Quality Score 225
Status Not validated
Chromosome 11
Chromosomal Location 32181963-32217707 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to A at 32184894 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Methionine to Leucine at position 372 (M372L)
Ref Sequence ENSEMBL: ENSMUSP00000105016 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000020528] [ENSMUST00000020530] [ENSMUST00000109389] [ENSMUST00000124640] [ENSMUST00000141859] [ENSMUST00000136903] [ENSMUST00000137950] [ENSMUST00000149526] [ENSMUST00000142964] [ENSMUST00000138050]
AlphaFold Q8VIJ8
Predicted Effect probably benign
Transcript: ENSMUST00000020528
SMART Domains Protein: ENSMUSP00000020528
Gene: ENSMUSG00000020287

DomainStartEndE-ValueType
low complexity region 2 14 N/A INTRINSIC
low complexity region 33 44 N/A INTRINSIC
Pfam:Pur_DNA_glyco 109 304 1.2e-61 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000020530
AA Change: M397L

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000020530
Gene: ENSMUSG00000020289
AA Change: M397L

DomainStartEndE-ValueType
Blast:DSPc 1 77 3e-27 BLAST
Pfam:NPR3 104 418 1.8e-44 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000109389
AA Change: M372L

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000105016
Gene: ENSMUSG00000020289
AA Change: M372L

DomainStartEndE-ValueType
Pfam:NPR3 63 108 8.3e-15 PFAM
Pfam:NPR3 104 395 3.1e-80 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000109390
Predicted Effect probably benign
Transcript: ENSMUST00000124640
SMART Domains Protein: ENSMUSP00000122085
Gene: ENSMUSG00000020289

DomainStartEndE-ValueType
Blast:DSPc 1 68 2e-30 BLAST
Predicted Effect noncoding transcript
Transcript: ENSMUST00000125256
Predicted Effect noncoding transcript
Transcript: ENSMUST00000148636
Predicted Effect noncoding transcript
Transcript: ENSMUST00000129573
Predicted Effect noncoding transcript
Transcript: ENSMUST00000146890
Predicted Effect probably benign
Transcript: ENSMUST00000141859
SMART Domains Protein: ENSMUSP00000120341
Gene: ENSMUSG00000020289

DomainStartEndE-ValueType
Blast:DSPc 1 59 2e-30 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000136903
Predicted Effect probably benign
Transcript: ENSMUST00000137950
SMART Domains Protein: ENSMUSP00000115594
Gene: ENSMUSG00000020289

DomainStartEndE-ValueType
Blast:DSPc 1 68 2e-30 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000149526
SMART Domains Protein: ENSMUSP00000122231
Gene: ENSMUSG00000020289

DomainStartEndE-ValueType
Pfam:NPR3 8 72 2.7e-14 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000142964
SMART Domains Protein: ENSMUSP00000118208
Gene: ENSMUSG00000020287

DomainStartEndE-ValueType
low complexity region 2 14 N/A INTRINSIC
low complexity region 33 44 N/A INTRINSIC
SCOP:d1ewna_ 102 125 5e-4 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000138050
SMART Domains Protein: ENSMUSP00000121960
Gene: ENSMUSG00000020287

DomainStartEndE-ValueType
low complexity region 2 14 N/A INTRINSIC
low complexity region 33 44 N/A INTRINSIC
SCOP:d1ewna_ 102 125 5e-4 SMART
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The function of the encoded protein is not known. [provided by RefSeq, Aug 2011]
PHENOTYPE: This gene is deleted in the Hbath-J mutation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 64 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Arap3 T A 18: 38,123,613 (GRCm39) E441V probably damaging Het
Arfip2 T A 7: 105,287,195 (GRCm39) D64V probably damaging Het
Atg9a C A 1: 75,162,329 (GRCm39) R527L probably damaging Het
Atp1a1 T G 3: 101,497,864 (GRCm39) I308L probably benign Het
Bcan T A 3: 87,903,888 (GRCm39) Y199F probably damaging Het
Bsn T C 9: 107,987,191 (GRCm39) probably benign Het
Ccdc158 A T 5: 92,780,367 (GRCm39) L902H probably damaging Het
Dnah7b A G 1: 46,163,672 (GRCm39) Y492C probably benign Het
Dnah9 G T 11: 65,963,605 (GRCm39) H1783N probably damaging Het
Dpep2 A G 8: 106,715,630 (GRCm39) V320A possibly damaging Het
Dsc2 A G 18: 20,178,559 (GRCm39) Y282H probably damaging Het
Egfr C T 11: 16,861,562 (GRCm39) P1114S probably benign Het
Fastkd1 A G 2: 69,530,477 (GRCm39) S560P probably damaging Het
Gm14295 G A 2: 176,502,895 (GRCm39) R795Q possibly damaging Het
Gpr155 C T 2: 73,212,471 (GRCm39) V51I probably benign Het
Gsap G A 5: 21,427,438 (GRCm39) probably null Het
Hecw1 T A 13: 14,552,291 (GRCm39) I103F probably damaging Het
Herc3 T A 6: 58,864,422 (GRCm39) N685K probably damaging Het
Hnrnph1 T A 11: 50,273,643 (GRCm39) D244E probably benign Het
Hydin A G 8: 111,308,681 (GRCm39) E3989G probably benign Het
Ibsp T C 5: 104,458,296 (GRCm39) Y278H probably damaging Het
Ift57 T G 16: 49,579,703 (GRCm39) N291K probably benign Het
Il15ra A G 2: 11,728,382 (GRCm39) T149A possibly damaging Het
Ints5 C T 19: 8,873,646 (GRCm39) T535I possibly damaging Het
Jarid2 T C 13: 45,056,015 (GRCm39) L268P probably damaging Het
Klhdc7a T A 4: 139,693,121 (GRCm39) T609S probably benign Het
Lrrc49 A G 9: 60,509,965 (GRCm39) V429A probably benign Het
Lsm3 T C 6: 91,499,254 (GRCm39) V87A possibly damaging Het
Man1c1 G C 4: 134,430,749 (GRCm39) P11R probably damaging Het
Map1a G T 2: 121,138,413 (GRCm39) V2726L probably damaging Het
Marveld3 A C 8: 110,688,478 (GRCm39) S88A probably benign Het
Mcm9 T C 10: 53,424,670 (GRCm39) D640G probably damaging Het
Mettl4 A G 17: 95,040,591 (GRCm39) I399T probably benign Het
Mmp27 T A 9: 7,577,379 (GRCm39) L274* probably null Het
Nacc2 A C 2: 25,950,235 (GRCm39) D500E probably benign Het
Or5p6 A T 7: 107,630,674 (GRCm39) I292N probably damaging Het
Otud7b T G 3: 96,060,837 (GRCm39) probably null Het
Pcx G A 19: 4,670,909 (GRCm39) R1070H probably benign Het
Ptprq C T 10: 107,426,855 (GRCm39) W1560* probably null Het
Puf60 A T 15: 75,942,313 (GRCm39) I520N probably damaging Het
Qars1 C T 9: 108,386,399 (GRCm39) R143C probably damaging Het
Rfx3 G A 19: 27,792,894 (GRCm39) Q322* probably null Het
Samd14 G T 11: 94,905,217 (GRCm39) V10L probably benign Het
Setd2 G A 9: 110,378,912 (GRCm39) R909Q probably benign Het
Sh2d4a T C 8: 68,749,316 (GRCm39) S117P probably benign Het
Sharpin C A 15: 76,234,866 (GRCm39) probably benign Het
Skor1 C A 9: 63,052,404 (GRCm39) A494S possibly damaging Het
Slc41a2 T C 10: 83,119,638 (GRCm39) T375A probably benign Het
Sparc G A 11: 55,286,627 (GRCm39) Q324* probably null Het
Spopfm2 T G 3: 94,083,605 (GRCm39) K69Q possibly damaging Het
Srebf1 T C 11: 60,097,328 (GRCm39) T171A probably benign Het
Srrd A G 5: 112,488,988 (GRCm39) I54T possibly damaging Het
Tecpr1 G T 5: 144,133,235 (GRCm39) Q1072K probably damaging Het
Tecpr1 A T 5: 144,148,274 (GRCm39) V377E probably benign Het
Tln1 T A 4: 43,545,721 (GRCm39) H919L probably benign Het
Tm9sf3 C T 19: 41,205,859 (GRCm39) S516N probably damaging Het
Trpa1 T A 1: 14,951,880 (GRCm39) T940S probably benign Het
Trpv4 G A 5: 114,782,771 (GRCm39) R64C probably damaging Het
Tufm A G 7: 126,088,019 (GRCm39) E174G probably benign Het
Urb2 A G 8: 124,757,841 (GRCm39) T1183A probably damaging Het
Virma A T 4: 11,527,843 (GRCm39) M1245L possibly damaging Het
Vmn2r32 T C 7: 7,477,614 (GRCm39) Y259C probably damaging Het
Zfp329 A G 7: 12,544,694 (GRCm39) F277L probably damaging Het
Zfp683 C T 4: 133,783,106 (GRCm39) T190I possibly damaging Het
Other mutations in Nprl3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02410:Nprl3 APN 11 32,217,539 (GRCm39) start codon destroyed probably null 0.99
IGL03055:Nprl3 APN 11 32,198,230 (GRCm39) intron probably benign
IGL03366:Nprl3 APN 11 32,200,256 (GRCm39) missense probably damaging 1.00
R0114:Nprl3 UTSW 11 32,189,784 (GRCm39) unclassified probably benign
R0555:Nprl3 UTSW 11 32,183,118 (GRCm39) critical splice acceptor site probably null
R0620:Nprl3 UTSW 11 32,184,876 (GRCm39) missense probably damaging 1.00
R2008:Nprl3 UTSW 11 32,182,973 (GRCm39) missense probably damaging 0.97
R2884:Nprl3 UTSW 11 32,198,163 (GRCm39) missense probably damaging 1.00
R3713:Nprl3 UTSW 11 32,205,464 (GRCm39) missense probably damaging 0.98
R3836:Nprl3 UTSW 11 32,183,082 (GRCm39) missense probably damaging 1.00
R4354:Nprl3 UTSW 11 32,184,906 (GRCm39) missense probably benign 0.00
R6052:Nprl3 UTSW 11 32,205,453 (GRCm39) missense possibly damaging 0.92
R6056:Nprl3 UTSW 11 32,217,432 (GRCm39) missense probably damaging 0.98
R6307:Nprl3 UTSW 11 32,189,828 (GRCm39) missense probably damaging 1.00
R6553:Nprl3 UTSW 11 32,184,812 (GRCm39) missense probably benign
R6585:Nprl3 UTSW 11 32,184,812 (GRCm39) missense probably benign
R6774:Nprl3 UTSW 11 32,187,381 (GRCm39) missense probably damaging 1.00
R6806:Nprl3 UTSW 11 32,217,509 (GRCm39) missense probably damaging 0.99
R7746:Nprl3 UTSW 11 32,198,150 (GRCm39) nonsense probably null
R7980:Nprl3 UTSW 11 32,187,357 (GRCm39) missense probably damaging 1.00
R8483:Nprl3 UTSW 11 32,213,083 (GRCm39) missense probably damaging 1.00
R8712:Nprl3 UTSW 11 32,187,334 (GRCm39) missense possibly damaging 0.84
R8827:Nprl3 UTSW 11 32,184,742 (GRCm39) missense probably benign 0.00
R9264:Nprl3 UTSW 11 32,183,948 (GRCm39) missense probably benign
Predicted Primers PCR Primer
(F):5'- ATGTCCTGGAAGGGGATCCTAC -3'
(R):5'- TTTCCCTGGGGTATGCTGAC -3'

Sequencing Primer
(F):5'- ATCCTACTTGGGGAGCCAAAGC -3'
(R):5'- GTATGCTGACCTTGCAGAGCTAC -3'
Posted On 2014-10-02