Incidental Mutation 'R2172:Hnrnph1'
ID 237574
Institutional Source Beutler Lab
Gene Symbol Hnrnph1
Ensembl Gene ENSMUSG00000007850
Gene Name heterogeneous nuclear ribonucleoprotein H1
Synonyms E430005G16Rik, Hnrph1
MMRRC Submission 040174-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock # R2172 (G1)
Quality Score 225
Status Not validated
Chromosome 11
Chromosomal Location 50376990-50386528 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to A at 50382816 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Aspartic acid to Glutamic Acid at position 244 (D244E)
Ref Sequence ENSEMBL: ENSMUSP00000104770 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000069304] [ENSMUST00000077817] [ENSMUST00000109142]
AlphaFold O35737
Predicted Effect probably benign
Transcript: ENSMUST00000069304
AA Change: D244E

PolyPhen 2 Score 0.108 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000070503
Gene: ENSMUSG00000007850
AA Change: D244E

DomainStartEndE-ValueType
RRM 12 86 3.77e-10 SMART
RRM 112 184 2.59e-8 SMART
low complexity region 236 254 N/A INTRINSIC
RRM 290 360 1.45e-11 SMART
low complexity region 383 401 N/A INTRINSIC
low complexity region 413 433 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000077817
AA Change: D244E

PolyPhen 2 Score 0.015 (Sensitivity: 0.96; Specificity: 0.79)
SMART Domains Protein: ENSMUSP00000076989
Gene: ENSMUSG00000007850
AA Change: D244E

DomainStartEndE-ValueType
RRM 12 86 3.77e-10 SMART
RRM 112 184 2.59e-8 SMART
low complexity region 236 254 N/A INTRINSIC
RRM 290 360 1.45e-11 SMART
low complexity region 383 401 N/A INTRINSIC
low complexity region 413 437 N/A INTRINSIC
low complexity region 451 472 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000109142
AA Change: D244E

PolyPhen 2 Score 0.108 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000104770
Gene: ENSMUSG00000007850
AA Change: D244E

DomainStartEndE-ValueType
RRM 12 86 3.77e-10 SMART
RRM 112 184 2.59e-8 SMART
low complexity region 236 254 N/A INTRINSIC
RRM 290 360 1.45e-11 SMART
low complexity region 383 401 N/A INTRINSIC
low complexity region 413 433 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000123371
Predicted Effect noncoding transcript
Transcript: ENSMUST00000126737
Predicted Effect noncoding transcript
Transcript: ENSMUST00000127964
Predicted Effect noncoding transcript
Transcript: ENSMUST00000128220
Predicted Effect noncoding transcript
Transcript: ENSMUST00000129631
Predicted Effect noncoding transcript
Transcript: ENSMUST00000132715
Predicted Effect noncoding transcript
Transcript: ENSMUST00000133435
Predicted Effect noncoding transcript
Transcript: ENSMUST00000134230
Predicted Effect noncoding transcript
Transcript: ENSMUST00000140056
Predicted Effect noncoding transcript
Transcript: ENSMUST00000150153
Predicted Effect noncoding transcript
Transcript: ENSMUST00000151537
Predicted Effect noncoding transcript
Transcript: ENSMUST00000156642
Predicted Effect noncoding transcript
Transcript: ENSMUST00000141668
Predicted Effect noncoding transcript
Transcript: ENSMUST00000143301
Predicted Effect noncoding transcript
Transcript: ENSMUST00000150657
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of a subfamily of ubiquitously expressed heterogeneous nuclear ribonucleoproteins (hnRNPs). The hnRNPs are RNA binding proteins that complex with heterogeneous nuclear RNA. These proteins are associated with pre-mRNAs in the nucleus and appear to influence pre-mRNA processing and other aspects of mRNA metabolism and transport. While all of the hnRNPs are present in the nucleus, some may shuttle between the nucleus and the cytoplasm. The hnRNP proteins have distinct nucleic acid binding properties. The protein encoded by this gene has three repeats of quasi-RRM domains that bind to RNA and is very similar to the family member HNRPF. This gene may be associated with hereditary lymphedema type I. Alternatively spliced transcript variants have been described [provided by RefSeq, Mar 2012]
Allele List at MGI
Other mutations in this stock
Total: 64 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Arap3 T A 18: 37,990,560 E441V probably damaging Het
Arfip2 T A 7: 105,637,988 D64V probably damaging Het
Atg9a C A 1: 75,185,685 R527L probably damaging Het
Atp1a1 T G 3: 101,590,548 I308L probably benign Het
Bcan T A 3: 87,996,581 Y199F probably damaging Het
Bsn T C 9: 108,109,992 probably benign Het
Ccdc158 A T 5: 92,632,508 L902H probably damaging Het
Dnah7b A G 1: 46,124,512 Y492C probably benign Het
Dnah9 G T 11: 66,072,779 H1783N probably damaging Het
Dpep2 A G 8: 105,988,998 V320A possibly damaging Het
Dsc2 A G 18: 20,045,502 Y282H probably damaging Het
Egfr C T 11: 16,911,562 P1114S probably benign Het
Fastkd1 A G 2: 69,700,133 S560P probably damaging Het
Gm10696 T G 3: 94,176,298 K69Q possibly damaging Het
Gm14295 G A 2: 176,811,102 R795Q possibly damaging Het
Gpr155 C T 2: 73,382,127 V51I probably benign Het
Gsap G A 5: 21,222,440 probably null Het
Hecw1 T A 13: 14,377,706 I103F probably damaging Het
Herc3 T A 6: 58,887,437 N685K probably damaging Het
Hydin A G 8: 110,582,049 E3989G probably benign Het
Ibsp T C 5: 104,310,430 Y278H probably damaging Het
Ift57 T G 16: 49,759,340 N291K probably benign Het
Il15ra A G 2: 11,723,571 T149A possibly damaging Het
Ints5 C T 19: 8,896,282 T535I possibly damaging Het
Jarid2 T C 13: 44,902,539 L268P probably damaging Het
Klhdc7a T A 4: 139,965,810 T609S probably benign Het
Lrrc49 A G 9: 60,602,682 V429A probably benign Het
Lsm3 T C 6: 91,522,272 V87A possibly damaging Het
Man1c1 G C 4: 134,703,438 P11R probably damaging Het
Map1a G T 2: 121,307,932 V2726L probably damaging Het
Marveld3 A C 8: 109,961,846 S88A probably benign Het
Mcm9 T C 10: 53,548,574 D640G probably damaging Het
Mettl4 A G 17: 94,733,163 I399T probably benign Het
Mmp27 T A 9: 7,577,378 L274* probably null Het
Nacc2 A C 2: 26,060,223 D500E probably benign Het
Nprl3 T A 11: 32,234,894 M372L probably benign Het
Olfr478 A T 7: 108,031,467 I292N probably damaging Het
Otud7b T G 3: 96,153,520 probably null Het
Pcx G A 19: 4,620,881 R1070H probably benign Het
Ptprq C T 10: 107,590,994 W1560* probably null Het
Puf60 A T 15: 76,070,464 I520N probably damaging Het
Qars C T 9: 108,509,200 R143C probably damaging Het
Rfx3 G A 19: 27,815,494 Q322* probably null Het
Samd14 G T 11: 95,014,391 V10L probably benign Het
Setd2 G A 9: 110,549,844 R909Q probably benign Het
Sh2d4a T C 8: 68,296,664 S117P probably benign Het
Sharpin C A 15: 76,350,666 probably benign Het
Skor1 C A 9: 63,145,122 A494S possibly damaging Het
Slc41a2 T C 10: 83,283,774 T375A probably benign Het
Sparc G A 11: 55,395,801 Q324* probably null Het
Srebf1 T C 11: 60,206,502 T171A probably benign Het
Srrd A G 5: 112,341,122 I54T possibly damaging Het
Tecpr1 G T 5: 144,196,417 Q1072K probably damaging Het
Tecpr1 A T 5: 144,211,456 V377E probably benign Het
Tln1 T A 4: 43,545,721 H919L probably benign Het
Tm9sf3 C T 19: 41,217,420 S516N probably damaging Het
Trpa1 T A 1: 14,881,656 T940S probably benign Het
Trpv4 G A 5: 114,644,710 R64C probably damaging Het
Tufm A G 7: 126,488,847 E174G probably benign Het
Urb2 A G 8: 124,031,102 T1183A probably damaging Het
Virma A T 4: 11,527,843 M1245L possibly damaging Het
Vmn2r32 T C 7: 7,474,615 Y259C probably damaging Het
Zfp329 A G 7: 12,810,767 F277L probably damaging Het
Zfp683 C T 4: 134,055,795 T190I possibly damaging Het
Other mutations in Hnrnph1
AlleleSourceChrCoordTypePredicted EffectPPH Score
R0480:Hnrnph1 UTSW 11 50385762 splice site probably benign
R3150:Hnrnph1 UTSW 11 50385792 missense probably benign
R4908:Hnrnph1 UTSW 11 50378410 missense probably damaging 0.97
R5661:Hnrnph1 UTSW 11 50384680 missense probably benign
R6194:Hnrnph1 UTSW 11 50383277 missense possibly damaging 0.89
R7501:Hnrnph1 UTSW 11 50379556 missense probably benign 0.00
R7650:Hnrnph1 UTSW 11 50383899 missense probably benign
R7745:Hnrnph1 UTSW 11 50379497 missense probably damaging 1.00
R8172:Hnrnph1 UTSW 11 50379905 missense probably damaging 0.99
X0021:Hnrnph1 UTSW 11 50379479 nonsense probably null
Predicted Primers PCR Primer
(F):5'- ACGAAAACTTATGGCCATGC -3'
(R):5'- TCTGGAAAGTAGAGCCACCG -3'

Sequencing Primer
(F):5'- AACTTATGGCCATGCAGCGG -3'
(R):5'- GTCCCCATATCTGTGGTCAG -3'
Posted On 2014-10-02