Incidental Mutation 'R0178:Ldb2'
ID23758
Institutional Source Beutler Lab
Gene Symbol Ldb2
Ensembl Gene ENSMUSG00000039706
Gene NameLIM domain binding 2
SynonymsCLIM1, CLP-36, Ldb3, CLIM-1b, CLIM-1a
MMRRC Submission 038446-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R0178 (G1)
Quality Score179
Status Validated (trace)
Chromosome5
Chromosomal Location44472132-44799680 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 44473499 bp
ZygosityHeterozygous
Amino Acid Change Valine to Glutamic Acid at position 300 (V300E)
Ref Sequence ENSEMBL: ENSMUSP00000143289 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000070748] [ENSMUST00000199256] [ENSMUST00000199261] [ENSMUST00000199534]
Predicted Effect possibly damaging
Transcript: ENSMUST00000070748
AA Change: V302E

PolyPhen 2 Score 0.524 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000067737
Gene: ENSMUSG00000039706
AA Change: V302E

DomainStartEndE-ValueType
Pfam:LIM_bind 30 232 9.9e-56 PFAM
low complexity region 249 281 N/A INTRINSIC
PDB:2JTN|A 293 337 2e-21 PDB
Predicted Effect probably benign
Transcript: ENSMUST00000199256
SMART Domains Protein: ENSMUSP00000143775
Gene: ENSMUSG00000039706

DomainStartEndE-ValueType
Pfam:LIM_bind 30 232 6.9e-56 PFAM
low complexity region 249 281 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000199261
AA Change: V300E

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000143289
Gene: ENSMUSG00000039706
AA Change: V300E

DomainStartEndE-ValueType
Pfam:LIM_bind 29 233 2.3e-68 PFAM
low complexity region 249 281 N/A INTRINSIC
PDB:2YPA|D 296 335 2e-20 PDB
Predicted Effect probably benign
Transcript: ENSMUST00000199534
SMART Domains Protein: ENSMUSP00000142442
Gene: ENSMUSG00000039706

DomainStartEndE-ValueType
Pfam:LIM_bind 29 233 2e-71 PFAM
low complexity region 249 281 N/A INTRINSIC
Meta Mutation Damage Score 0.8259 question?
Coding Region Coverage
  • 1x: 98.9%
  • 3x: 98.1%
  • 10x: 95.5%
  • 20x: 88.8%
Validation Efficiency 95% (69/73)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the LIM-domain binding family. Members of this family are characterized by a conserved nuclear localization sequence, an amino-terminal homodimerization domain and a carboxy-terminal LIM interaction domain. These proteins function as adapter molecules to allow assembly of transcriptional regulatory complexes. Genetic association studies suggest functions for this gene in rhegmatogenous retinal detachment and coronary artery disease. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jan 2015]
PHENOTYPE: Homozygous mutation of this gene results in no obvious phenotype. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 53 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700125H20Rik A G 11: 85,178,438 H94R probably benign Het
4922502D21Rik T C 6: 129,326,823 R60G probably benign Het
4930596D02Rik T G 14: 35,811,478 N111T probably benign Het
9930021J03Rik A G 19: 29,754,788 S342P probably damaging Het
Abca1 T C 4: 53,081,953 D769G possibly damaging Het
Adcy6 G T 15: 98,604,215 Q173K probably benign Het
Amotl1 G A 9: 14,548,773 A890V probably benign Het
Arfgap2 C T 2: 91,267,361 A141V probably benign Het
Asb2 G A 12: 103,325,552 P324L probably damaging Het
Cacna1g G A 11: 94,463,483 T202I probably damaging Het
Capn5 A G 7: 98,132,891 L214P probably damaging Het
Cdh20 A T 1: 104,975,051 D489V possibly damaging Het
Cers5 C A 15: 99,747,024 probably benign Het
Chrnb3 T A 8: 27,393,364 V111D probably damaging Het
Colec12 C T 18: 9,858,921 P568L unknown Het
Cyp2r1 T C 7: 114,550,408 E248G probably damaging Het
Dnmt3b A G 2: 153,675,018 T536A probably benign Het
Eef2 G A 10: 81,180,292 V496M possibly damaging Het
Fam118a T C 15: 85,045,880 probably benign Het
Fer1l6 T A 15: 58,637,914 probably null Het
Fhad1 A C 4: 141,955,340 F497V probably benign Het
Gbe1 G A 16: 70,478,386 G358D probably damaging Het
Gdf10 A G 14: 33,924,101 D69G probably damaging Het
Ggt6 A G 11: 72,436,818 H150R possibly damaging Het
Gm1966 A T 7: 106,601,821 Y739N probably damaging Het
Gm45713 A T 7: 45,134,458 L110Q probably damaging Het
Gm9847 T C 12: 14,494,648 noncoding transcript Het
Grwd1 T C 7: 45,830,630 E51G probably damaging Het
H13 A G 2: 152,681,067 Y100C probably damaging Het
Kcne1 A C 16: 92,348,809 M49R probably damaging Het
Kcnma1 C T 14: 23,526,767 R236H probably damaging Het
Knl1 T A 2: 119,058,405 probably benign Het
Krt40 T C 11: 99,541,739 I150M probably damaging Het
Lrp1b A T 2: 40,725,907 C3606S probably damaging Het
Lrrc42 A G 4: 107,247,720 I16T probably damaging Het
Lrrc6 A C 15: 66,454,101 D208E probably benign Het
Mtus1 G T 8: 41,002,361 L87I possibly damaging Het
Myot T C 18: 44,336,986 F10S probably damaging Het
Nrg3 A T 14: 38,376,456 H480Q probably damaging Het
Olfr205 A T 16: 59,329,420 F30I probably damaging Het
Olfr691 G A 7: 105,336,922 R265C probably benign Het
Prl2c5 A T 13: 13,191,805 D220V probably damaging Het
Rbm17 G A 2: 11,587,779 S295L probably benign Het
Serpina6 A G 12: 103,646,913 I376T probably damaging Het
Sh2d2a A T 3: 87,849,423 T192S probably benign Het
Slc27a1 T C 8: 71,584,462 Y417H possibly damaging Het
Slc6a1 T G 6: 114,304,852 I32S possibly damaging Het
Sntb1 T C 15: 55,906,144 T150A probably damaging Het
Tanc1 T A 2: 59,835,447 C1183* probably null Het
Tmprss7 C A 16: 45,690,843 W57C probably damaging Het
Ubac1 A T 2: 26,021,428 V36E possibly damaging Het
Zfc3h1 T C 10: 115,406,725 probably benign Het
Zfp644 C T 5: 106,636,905 C592Y probably damaging Het
Other mutations in Ldb2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00504:Ldb2 APN 5 44541684 splice site probably null
IGL01757:Ldb2 APN 5 44541867 splice site probably benign
IGL01936:Ldb2 APN 5 44480244 missense probably damaging 1.00
IGL03105:Ldb2 APN 5 44799373 missense possibly damaging 0.70
IGL03108:Ldb2 APN 5 44541715 missense probably damaging 1.00
R0152:Ldb2 UTSW 5 44541799 missense possibly damaging 0.86
R0841:Ldb2 UTSW 5 44532674 missense probably damaging 1.00
R1145:Ldb2 UTSW 5 44532674 missense probably damaging 1.00
R1145:Ldb2 UTSW 5 44532674 missense probably damaging 1.00
R1318:Ldb2 UTSW 5 44535037 critical splice donor site probably null
R1607:Ldb2 UTSW 5 44473472 missense probably damaging 0.99
R2863:Ldb2 UTSW 5 44480324 missense probably damaging 0.99
R3803:Ldb2 UTSW 5 44473394 missense probably benign 0.38
R4502:Ldb2 UTSW 5 44669407 missense probably damaging 1.00
R4613:Ldb2 UTSW 5 44476551 missense probably benign 0.27
R4985:Ldb2 UTSW 5 44480303 missense probably damaging 1.00
R5475:Ldb2 UTSW 5 44541832 missense probably damaging 1.00
R5512:Ldb2 UTSW 5 44480244 missense probably damaging 1.00
R6058:Ldb2 UTSW 5 44476563 missense possibly damaging 0.66
R6282:Ldb2 UTSW 5 44532665 missense probably damaging 1.00
R6438:Ldb2 UTSW 5 44480310 missense probably damaging 0.98
R6770:Ldb2 UTSW 5 44669396 missense probably damaging 0.99
R6830:Ldb2 UTSW 5 44541857 missense probably damaging 1.00
R8061:Ldb2 UTSW 5 44480270 missense probably damaging 1.00
X0026:Ldb2 UTSW 5 44532728 missense probably damaging 0.99
X0028:Ldb2 UTSW 5 44541794 missense probably benign 0.04
Predicted Primers PCR Primer
(F):5'- ATGGACAGCGTAATCAGGTGCCAG -3'
(R):5'- GCGTGGTTGTTACACATCAGGAGG -3'

Sequencing Primer
(F):5'- CAGTAGCCCATCTTACTGGGAAG -3'
(R):5'- AGCGCACAAAGTGTGTCT -3'
Posted On2013-04-16