Mutagenetix > Incidental Mutation

Incidental Mutation 'R2172:Jarid2'

237580

Institutional Source

Beutler Lab

Gene Symbol

Jarid2

Ensembl Gene

ENSMUSG00000038518

Gene Name

jumonji, AT rich interactive domain 2

Synonyms

jumonji, Jmj

MMRRC Submission

040174-MU

Accession Numbers

Is this an essential gene?

Essential (E-score: 1.000) question?

Stock #

R2172 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

44729474-44921643 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 44902539 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Leucine to Proline at position 268 (L268P)

Ref Sequence

ENSEMBL: ENSMUSP00000134658 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000044608] [ENSMUST00000173246] [ENSMUST00000173367] [ENSMUST00000173704] [ENSMUST00000173906]

AlphaFold

Q62315

Predicted Effect

probably damaging
Transcript: ENSMUST00000044608
AA Change: L407P

PolyPhen 2 Score 0.985 (Sensitivity: 0.74; Specificity: 0.96)

SMART Domains

Protein: ENSMUSP00000037774
Gene: ENSMUSG00000038518
AA Change: L407P

Domain	Start	End	E-Value	Type
low complexity region	86	99	N/A	INTRINSIC
low complexity region	181	195	N/A	INTRINSIC
low complexity region	265	285	N/A	INTRINSIC
low complexity region	334	353	N/A	INTRINSIC
JmjN	554	595	1.77e-20	SMART
ARID	616	707	4.96e-24	SMART
BRIGHT	620	712	1.7e-29	SMART
low complexity region	791	800	N/A	INTRINSIC
JmjC	882	1046	1.04e-50	SMART
Pfam:zf-C5HC2	1137	1191	2.4e-14	PFAM

Predicted Effect

probably damaging
Transcript: ENSMUST00000173246
AA Change: L407P

PolyPhen 2 Score 0.985 (Sensitivity: 0.74; Specificity: 0.96)

SMART Domains

Protein: ENSMUSP00000134205
Gene: ENSMUSG00000038518
AA Change: L407P

Domain	Start	End	E-Value	Type
low complexity region	86	99	N/A	INTRINSIC
low complexity region	181	195	N/A	INTRINSIC
low complexity region	265	285	N/A	INTRINSIC
low complexity region	334	353	N/A	INTRINSIC
JmjN	554	595	1.77e-20	SMART
ARID	616	707	4.96e-24	SMART
BRIGHT	620	712	1.7e-29	SMART
low complexity region	791	800	N/A	INTRINSIC
JmjC	882	1046	1.04e-50	SMART
Pfam:zf-C5HC2	1137	1191	2.4e-14	PFAM

Predicted Effect

probably damaging
Transcript: ENSMUST00000173367
AA Change: L268P

PolyPhen 2 Score 0.990 (Sensitivity: 0.72; Specificity: 0.97)

SMART Domains

Protein: ENSMUSP00000134658
Gene: ENSMUSG00000038518
AA Change: L268P

Domain	Start	End	E-Value	Type
low complexity region	42	56	N/A	INTRINSIC
low complexity region	126	146	N/A	INTRINSIC
low complexity region	195	214	N/A	INTRINSIC
JmjN	415	456	1.77e-20	SMART
PDB:2RQ5\|A	476	507	3e-14	PDB
Blast:ARID	477	507	2e-14	BLAST

Predicted Effect

probably damaging
Transcript: ENSMUST00000173704
AA Change: L407P

PolyPhen 2 Score 0.985 (Sensitivity: 0.74; Specificity: 0.96)

SMART Domains

Protein: ENSMUSP00000134675
Gene: ENSMUSG00000038518
AA Change: L407P

Domain	Start	End	E-Value	Type
low complexity region	86	99	N/A	INTRINSIC
low complexity region	181	195	N/A	INTRINSIC
low complexity region	265	285	N/A	INTRINSIC
low complexity region	334	353	N/A	INTRINSIC
JmjN	554	595	1.77e-20	SMART
ARID	616	707	4.96e-24	SMART
BRIGHT	620	712	1.7e-29	SMART
low complexity region	791	800	N/A	INTRINSIC
JmjC	882	1046	1.04e-50	SMART
Pfam:zf-C5HC2	1137	1190	1e-10	PFAM

Predicted Effect

possibly damaging
Transcript: ENSMUST00000173906
AA Change: L369P

PolyPhen 2 Score 0.909 (Sensitivity: 0.81; Specificity: 0.94)

SMART Domains

Protein: ENSMUSP00000134630
Gene: ENSMUSG00000038518
AA Change: L369P

Domain	Start	End	E-Value	Type
low complexity region	48	61	N/A	INTRINSIC
low complexity region	143	157	N/A	INTRINSIC
low complexity region	227	247	N/A	INTRINSIC
low complexity region	296	315	N/A	INTRINSIC
JmjN	516	557	1.77e-20	SMART
ARID	578	669	4.96e-24	SMART
BRIGHT	582	674	1.7e-29	SMART
low complexity region	753	762	N/A	INTRINSIC
JmjC	844	1008	1.04e-50	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000174683

Coding Region Coverage

1x: 99.2%
3x: 98.7%
10x: 97.4%
20x: 95.4%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a Jumonji- and AT-rich interaction domain (ARID)-domain-containing protein. The encoded protein is a DNA-binding protein that functions as a transcriptional repressor. This protein interacts with the Polycomb repressive complex 2 (PRC2) which plays an essential role in regulating gene expression during embryonic development. This protein facilitates the recruitment of the PRC2 complex to target genes. Alternate splicing results in multiple transcript variants. Mutations in this gene are associated with chronic myeloid malignancies. [provided by RefSeq, May 2012]
PHENOTYPE: Homozygous mutants show strain-specific phenotypes, including embryonic death and defective neural tube closure, impaired hematopoiesis and hypoplasia of liver, thymus and spleen. Homozygotes for another mutation die at birth with cardiac defects. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 64 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Arap3	T	A	18: 37,990,560	E441V	probably damaging	Het
Arfip2	T	A	7: 105,637,988	D64V	probably damaging	Het
Atg9a	C	A	1: 75,185,685	R527L	probably damaging	Het
Atp1a1	T	G	3: 101,590,548	I308L	probably benign	Het
Bcan	T	A	3: 87,996,581	Y199F	probably damaging	Het
Bsn	T	C	9: 108,109,992		probably benign	Het
Ccdc158	A	T	5: 92,632,508	L902H	probably damaging	Het
Dnah7b	A	G	1: 46,124,512	Y492C	probably benign	Het
Dnah9	G	T	11: 66,072,779	H1783N	probably damaging	Het
Dpep2	A	G	8: 105,988,998	V320A	possibly damaging	Het
Dsc2	A	G	18: 20,045,502	Y282H	probably damaging	Het
Egfr	C	T	11: 16,911,562	P1114S	probably benign	Het
Fastkd1	A	G	2: 69,700,133	S560P	probably damaging	Het
Gm10696	T	G	3: 94,176,298	K69Q	possibly damaging	Het
Gm14295	G	A	2: 176,811,102	R795Q	possibly damaging	Het
Gpr155	C	T	2: 73,382,127	V51I	probably benign	Het
Gsap	G	A	5: 21,222,440		probably null	Het
Hecw1	T	A	13: 14,377,706	I103F	probably damaging	Het
Herc3	T	A	6: 58,887,437	N685K	probably damaging	Het
Hnrnph1	T	A	11: 50,382,816	D244E	probably benign	Het
Hydin	A	G	8: 110,582,049	E3989G	probably benign	Het
Ibsp	T	C	5: 104,310,430	Y278H	probably damaging	Het
Ift57	T	G	16: 49,759,340	N291K	probably benign	Het
Il15ra	A	G	2: 11,723,571	T149A	possibly damaging	Het
Ints5	C	T	19: 8,896,282	T535I	possibly damaging	Het
Klhdc7a	T	A	4: 139,965,810	T609S	probably benign	Het
Lrrc49	A	G	9: 60,602,682	V429A	probably benign	Het
Lsm3	T	C	6: 91,522,272	V87A	possibly damaging	Het
Man1c1	G	C	4: 134,703,438	P11R	probably damaging	Het
Map1a	G	T	2: 121,307,932	V2726L	probably damaging	Het
Marveld3	A	C	8: 109,961,846	S88A	probably benign	Het
Mcm9	T	C	10: 53,548,574	D640G	probably damaging	Het
Mettl4	A	G	17: 94,733,163	I399T	probably benign	Het
Mmp27	T	A	9: 7,577,378	L274*	probably null	Het
Nacc2	A	C	2: 26,060,223	D500E	probably benign	Het
Nprl3	T	A	11: 32,234,894	M372L	probably benign	Het
Olfr478	A	T	7: 108,031,467	I292N	probably damaging	Het
Otud7b	T	G	3: 96,153,520		probably null	Het
Pcx	G	A	19: 4,620,881	R1070H	probably benign	Het
Ptprq	C	T	10: 107,590,994	W1560*	probably null	Het
Puf60	A	T	15: 76,070,464	I520N	probably damaging	Het
Qars	C	T	9: 108,509,200	R143C	probably damaging	Het
Rfx3	G	A	19: 27,815,494	Q322*	probably null	Het
Samd14	G	T	11: 95,014,391	V10L	probably benign	Het
Setd2	G	A	9: 110,549,844	R909Q	probably benign	Het
Sh2d4a	T	C	8: 68,296,664	S117P	probably benign	Het
Sharpin	C	A	15: 76,350,666		probably benign	Het
Skor1	C	A	9: 63,145,122	A494S	possibly damaging	Het
Slc41a2	T	C	10: 83,283,774	T375A	probably benign	Het
Sparc	G	A	11: 55,395,801	Q324*	probably null	Het
Srebf1	T	C	11: 60,206,502	T171A	probably benign	Het
Srrd	A	G	5: 112,341,122	I54T	possibly damaging	Het
Tecpr1	G	T	5: 144,196,417	Q1072K	probably damaging	Het
Tecpr1	A	T	5: 144,211,456	V377E	probably benign	Het
Tln1	T	A	4: 43,545,721	H919L	probably benign	Het
Tm9sf3	C	T	19: 41,217,420	S516N	probably damaging	Het
Trpa1	T	A	1: 14,881,656	T940S	probably benign	Het
Trpv4	G	A	5: 114,644,710	R64C	probably damaging	Het
Tufm	A	G	7: 126,488,847	E174G	probably benign	Het
Urb2	A	G	8: 124,031,102	T1183A	probably damaging	Het
Virma	A	T	4: 11,527,843	M1245L	possibly damaging	Het
Vmn2r32	T	C	7: 7,474,615	Y259C	probably damaging	Het
Zfp329	A	G	7: 12,810,767	F277L	probably damaging	Het
Zfp683	C	T	4: 134,055,795	T190I	possibly damaging	Het

Other mutations in Jarid2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01572:Jarid2	APN	13	44884835	missense	probably damaging	1.00
IGL02217:Jarid2	APN	13	44913201	missense	probably damaging	1.00
IGL02378:Jarid2	APN	13	44914325	missense	probably damaging	0.98
IGL02604:Jarid2	APN	13	44874401	missense	probably damaging	1.00
IGL02865:Jarid2	APN	13	44910560	missense	probably damaging	1.00
IGL02926:Jarid2	APN	13	44902929	missense	probably benign	0.03
R0057:Jarid2	UTSW	13	44884856	missense	probably damaging	0.96
R0426:Jarid2	UTSW	13	44840882	critical splice donor site	probably null
R0545:Jarid2	UTSW	13	44902831	missense	probably benign	0.10
R0562:Jarid2	UTSW	13	44902359	missense	probably damaging	0.99
R1192:Jarid2	UTSW	13	44906545	missense	probably damaging	1.00
R1241:Jarid2	UTSW	13	44884892	splice site	probably benign
R1254:Jarid2	UTSW	13	44906276	missense	probably damaging	1.00
R1464:Jarid2	UTSW	13	44848381	missense	probably damaging	0.97
R1464:Jarid2	UTSW	13	44848381	missense	probably damaging	0.97
R1552:Jarid2	UTSW	13	44911199	missense	probably damaging	1.00
R1728:Jarid2	UTSW	13	44906276	missense	probably damaging	1.00
R1729:Jarid2	UTSW	13	44906276	missense	probably damaging	1.00
R1730:Jarid2	UTSW	13	44906276	missense	probably damaging	1.00
R1739:Jarid2	UTSW	13	44906276	missense	probably damaging	1.00
R1783:Jarid2	UTSW	13	44906276	missense	probably damaging	1.00
R1785:Jarid2	UTSW	13	44906276	missense	probably damaging	1.00
R1844:Jarid2	UTSW	13	44902743	missense	possibly damaging	0.71
R1896:Jarid2	UTSW	13	44884882	critical splice donor site	probably null
R1965:Jarid2	UTSW	13	44906276	missense	probably damaging	1.00
R1966:Jarid2	UTSW	13	44906276	missense	probably damaging	1.00
R1995:Jarid2	UTSW	13	44874441	missense	probably damaging	1.00
R2120:Jarid2	UTSW	13	44906336	missense	probably benign	0.17
R2142:Jarid2	UTSW	13	44906276	missense	probably damaging	1.00
R2242:Jarid2	UTSW	13	44906276	missense	probably damaging	1.00
R2245:Jarid2	UTSW	13	44906276	missense	probably damaging	1.00
R3110:Jarid2	UTSW	13	44906276	missense	probably damaging	1.00
R3111:Jarid2	UTSW	13	44906276	missense	probably damaging	1.00
R3112:Jarid2	UTSW	13	44906276	missense	probably damaging	1.00
R3115:Jarid2	UTSW	13	44896466	missense	probably damaging	1.00
R3620:Jarid2	UTSW	13	44906276	missense	probably damaging	1.00
R3704:Jarid2	UTSW	13	44902355	missense	probably benign
R3802:Jarid2	UTSW	13	44902831	missense	probably benign	0.10
R3804:Jarid2	UTSW	13	44902831	missense	probably benign	0.10
R4126:Jarid2	UTSW	13	44902256	missense	probably damaging	1.00
R4127:Jarid2	UTSW	13	44902256	missense	probably damaging	1.00
R4128:Jarid2	UTSW	13	44902256	missense	probably damaging	1.00
R4153:Jarid2	UTSW	13	44910426	missense	probably damaging	1.00
R4844:Jarid2	UTSW	13	44913772	missense	probably damaging	0.96
R5044:Jarid2	UTSW	13	44906565	missense	probably damaging	1.00
R5329:Jarid2	UTSW	13	44906271	missense	possibly damaging	0.49
R5632:Jarid2	UTSW	13	44896290	missense	probably damaging	0.97
R5820:Jarid2	UTSW	13	44902301	missense	possibly damaging	0.96
R6267:Jarid2	UTSW	13	44903063	missense	possibly damaging	0.93
R6296:Jarid2	UTSW	13	44903063	missense	possibly damaging	0.93
R6479:Jarid2	UTSW	13	44848289	missense	probably benign	0.22
R6619:Jarid2	UTSW	13	44874396	missense	probably damaging	1.00
R6633:Jarid2	UTSW	13	44884877	missense	probably damaging	0.97
R6970:Jarid2	UTSW	13	44902985	missense	probably damaging	1.00
R7020:Jarid2	UTSW	13	44884824	missense	probably damaging	1.00
R7155:Jarid2	UTSW	13	44902462	missense	probably damaging	1.00
R7223:Jarid2	UTSW	13	44896322	missense	possibly damaging	0.89
R7265:Jarid2	UTSW	13	44902272	missense	probably benign	0.29
R8321:Jarid2	UTSW	13	44848386	missense	probably damaging	0.96
R8872:Jarid2	UTSW	13	44902508	missense	possibly damaging	0.88
R9064:Jarid2	UTSW	13	44840850	missense
R9065:Jarid2	UTSW	13	44840850	missense
R9067:Jarid2	UTSW	13	44840850	missense
R9153:Jarid2	UTSW	13	44911202	missense	probably damaging	1.00
R9163:Jarid2	UTSW	13	44911251	missense	possibly damaging	0.92
R9468:Jarid2	UTSW	13	44919830	missense	probably damaging	1.00
R9541:Jarid2	UTSW	13	44914777	missense	possibly damaging	0.93
R9558:Jarid2	UTSW	13	44914777	missense	possibly damaging	0.93
R9559:Jarid2	UTSW	13	44914777	missense	possibly damaging	0.93

Predicted Primers

PCR Primer
(F):5'- CAAGGGGACTGTCACATACACC -3'
(R):5'- AGACTTTTCTCCTGAAGCCGC -3'

Sequencing Primer
(F):5'- CCAAAGCCAAGAGAGAACTGGTC -3'
(R):5'- TTTCTCCTGAAGCCGCTGAGG -3'

Posted On

2014-10-02