Incidental Mutation 'R2172:Pcx'
ID 237588
Institutional Source Beutler Lab
Gene Symbol Pcx
Ensembl Gene ENSMUSG00000024892
Gene Name pyruvate carboxylase
Synonyms Pc
MMRRC Submission 040174-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock # R2172 (G1)
Quality Score 225
Status Not validated
Chromosome 19
Chromosomal Location 4510472-4621752 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) G to A at 4620881 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Arginine to Histidine at position 1070 (R1070H)
Ref Sequence ENSEMBL: ENSMUSP00000153479 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000025823] [ENSMUST00000068004] [ENSMUST00000113825] [ENSMUST00000177696] [ENSMUST00000224675] [ENSMUST00000224707] [ENSMUST00000224726] [ENSMUST00000225264] [ENSMUST00000225375] [ENSMUST00000225476] [ENSMUST00000225896]
AlphaFold no structure available at present
Predicted Effect probably benign
Transcript: ENSMUST00000025823
SMART Domains Protein: ENSMUSP00000025823
Gene: ENSMUSG00000024889

DomainStartEndE-ValueType
transmembrane domain 34 56 N/A INTRINSIC
low complexity region 72 88 N/A INTRINSIC
transmembrane domain 112 134 N/A INTRINSIC
Pfam:Abi 147 267 1.4e-19 PFAM
transmembrane domain 283 302 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000068004
AA Change: R1071H

PolyPhen 2 Score 0.169 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000063825
Gene: ENSMUSG00000024892
AA Change: R1071H

DomainStartEndE-ValueType
low complexity region 8 22 N/A INTRINSIC
Pfam:CPSase_L_chain 37 147 3.3e-45 PFAM
Pfam:ATP-grasp_4 149 334 3.9e-19 PFAM
Pfam:CPSase_L_D2 152 361 7.2e-77 PFAM
Pfam:Dala_Dala_lig_C 161 329 1.5e-11 PFAM
Biotin_carb_C 376 483 1.21e-50 SMART
low complexity region 513 541 N/A INTRINSIC
Pfam:HMGL-like 564 838 8.2e-29 PFAM
Pfam:PYC_OADA 862 1062 1.4e-72 PFAM
Pfam:Biotin_lipoyl 1111 1178 1.4e-20 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000113825
AA Change: R1070H

PolyPhen 2 Score 0.169 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000109456
Gene: ENSMUSG00000024892
AA Change: R1070H

DomainStartEndE-ValueType
low complexity region 7 21 N/A INTRINSIC
Pfam:CPSase_L_chain 36 146 1.1e-43 PFAM
Pfam:ATP-grasp_4 148 332 2.9e-19 PFAM
Pfam:CPSase_L_D2 151 360 4.2e-77 PFAM
Pfam:Dala_Dala_lig_C 158 328 7.9e-13 PFAM
Biotin_carb_C 375 482 1.21e-50 SMART
low complexity region 512 540 N/A INTRINSIC
Pfam:HMGL-like 571 821 3.4e-28 PFAM
Pfam:PYC_OADA 861 1062 3.4e-69 PFAM
Pfam:Biotin_lipoyl 1110 1177 1.8e-21 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000177696
SMART Domains Protein: ENSMUSP00000136515
Gene: ENSMUSG00000071691

DomainStartEndE-ValueType
low complexity region 65 79 N/A INTRINSIC
low complexity region 106 122 N/A INTRINSIC
low complexity region 128 140 N/A INTRINSIC
Pfam:DUF4554 274 719 5.3e-206 PFAM
low complexity region 720 731 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000184483
Predicted Effect noncoding transcript
Transcript: ENSMUST00000223788
Predicted Effect probably benign
Transcript: ENSMUST00000224675
Predicted Effect probably benign
Transcript: ENSMUST00000224707
Predicted Effect probably benign
Transcript: ENSMUST00000224726
AA Change: R1070H

PolyPhen 2 Score 0.169 (Sensitivity: 0.92; Specificity: 0.87)
Predicted Effect probably benign
Transcript: ENSMUST00000225264
Predicted Effect noncoding transcript
Transcript: ENSMUST00000225285
Predicted Effect probably benign
Transcript: ENSMUST00000225375
Predicted Effect noncoding transcript
Transcript: ENSMUST00000226012
Predicted Effect noncoding transcript
Transcript: ENSMUST00000225509
Predicted Effect probably benign
Transcript: ENSMUST00000225476
Predicted Effect probably benign
Transcript: ENSMUST00000225896
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes pyruvate carboxylase, which requires biotin and ATP to catalyse the carboxylation of pyruvate to oxaloacetate. The active enzyme is a homotetramer arranged in a tetrahedron which is located exclusively in the mitochondrial matrix. Pyruvate carboxylase is involved in gluconeogenesis, lipogenesis, insulin secretion and synthesis of the neurotransmitter glutamate. Mutations in this gene have been associated with pyruvate carboxylase deficiency. Alternatively spliced transcript variants with different 5' UTRs, but encoding the same protein, have been found for this gene. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 64 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Arap3 T A 18: 37,990,560 E441V probably damaging Het
Arfip2 T A 7: 105,637,988 D64V probably damaging Het
Atg9a C A 1: 75,185,685 R527L probably damaging Het
Atp1a1 T G 3: 101,590,548 I308L probably benign Het
Bcan T A 3: 87,996,581 Y199F probably damaging Het
Bsn T C 9: 108,109,992 probably benign Het
Ccdc158 A T 5: 92,632,508 L902H probably damaging Het
Dnah7b A G 1: 46,124,512 Y492C probably benign Het
Dnah9 G T 11: 66,072,779 H1783N probably damaging Het
Dpep2 A G 8: 105,988,998 V320A possibly damaging Het
Dsc2 A G 18: 20,045,502 Y282H probably damaging Het
Egfr C T 11: 16,911,562 P1114S probably benign Het
Fastkd1 A G 2: 69,700,133 S560P probably damaging Het
Gm10696 T G 3: 94,176,298 K69Q possibly damaging Het
Gm14295 G A 2: 176,811,102 R795Q possibly damaging Het
Gpr155 C T 2: 73,382,127 V51I probably benign Het
Gsap G A 5: 21,222,440 probably null Het
Hecw1 T A 13: 14,377,706 I103F probably damaging Het
Herc3 T A 6: 58,887,437 N685K probably damaging Het
Hnrnph1 T A 11: 50,382,816 D244E probably benign Het
Hydin A G 8: 110,582,049 E3989G probably benign Het
Ibsp T C 5: 104,310,430 Y278H probably damaging Het
Ift57 T G 16: 49,759,340 N291K probably benign Het
Il15ra A G 2: 11,723,571 T149A possibly damaging Het
Ints5 C T 19: 8,896,282 T535I possibly damaging Het
Jarid2 T C 13: 44,902,539 L268P probably damaging Het
Klhdc7a T A 4: 139,965,810 T609S probably benign Het
Lrrc49 A G 9: 60,602,682 V429A probably benign Het
Lsm3 T C 6: 91,522,272 V87A possibly damaging Het
Man1c1 G C 4: 134,703,438 P11R probably damaging Het
Map1a G T 2: 121,307,932 V2726L probably damaging Het
Marveld3 A C 8: 109,961,846 S88A probably benign Het
Mcm9 T C 10: 53,548,574 D640G probably damaging Het
Mettl4 A G 17: 94,733,163 I399T probably benign Het
Mmp27 T A 9: 7,577,378 L274* probably null Het
Nacc2 A C 2: 26,060,223 D500E probably benign Het
Nprl3 T A 11: 32,234,894 M372L probably benign Het
Olfr478 A T 7: 108,031,467 I292N probably damaging Het
Otud7b T G 3: 96,153,520 probably null Het
Ptprq C T 10: 107,590,994 W1560* probably null Het
Puf60 A T 15: 76,070,464 I520N probably damaging Het
Qars C T 9: 108,509,200 R143C probably damaging Het
Rfx3 G A 19: 27,815,494 Q322* probably null Het
Samd14 G T 11: 95,014,391 V10L probably benign Het
Setd2 G A 9: 110,549,844 R909Q probably benign Het
Sh2d4a T C 8: 68,296,664 S117P probably benign Het
Sharpin C A 15: 76,350,666 probably benign Het
Skor1 C A 9: 63,145,122 A494S possibly damaging Het
Slc41a2 T C 10: 83,283,774 T375A probably benign Het
Sparc G A 11: 55,395,801 Q324* probably null Het
Srebf1 T C 11: 60,206,502 T171A probably benign Het
Srrd A G 5: 112,341,122 I54T possibly damaging Het
Tecpr1 G T 5: 144,196,417 Q1072K probably damaging Het
Tecpr1 A T 5: 144,211,456 V377E probably benign Het
Tln1 T A 4: 43,545,721 H919L probably benign Het
Tm9sf3 C T 19: 41,217,420 S516N probably damaging Het
Trpa1 T A 1: 14,881,656 T940S probably benign Het
Trpv4 G A 5: 114,644,710 R64C probably damaging Het
Tufm A G 7: 126,488,847 E174G probably benign Het
Urb2 A G 8: 124,031,102 T1183A probably damaging Het
Virma A T 4: 11,527,843 M1245L possibly damaging Het
Vmn2r32 T C 7: 7,474,615 Y259C probably damaging Het
Zfp329 A G 7: 12,810,767 F277L probably damaging Het
Zfp683 C T 4: 134,055,795 T190I possibly damaging Het
Other mutations in Pcx
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00924:Pcx APN 19 4620937 missense probably benign 0.02
IGL01339:Pcx APN 19 4620235 splice site probably null
IGL01373:Pcx APN 19 4620235 splice site probably null
IGL01704:Pcx APN 19 4621060 missense probably damaging 1.00
IGL02223:Pcx APN 19 4601978 missense probably damaging 1.00
PIT4151001:Pcx UTSW 19 4603129 missense probably damaging 1.00
R0098:Pcx UTSW 19 4601747 splice site probably benign
R0098:Pcx UTSW 19 4601747 splice site probably benign
R0211:Pcx UTSW 19 4620199 missense probably damaging 1.00
R0211:Pcx UTSW 19 4620199 missense probably damaging 1.00
R0398:Pcx UTSW 19 4601610 missense probably benign 0.35
R0414:Pcx UTSW 19 4607642 missense possibly damaging 0.60
R1402:Pcx UTSW 19 4602030 missense possibly damaging 0.59
R1402:Pcx UTSW 19 4602030 missense possibly damaging 0.59
R1479:Pcx UTSW 19 4602024 missense probably damaging 1.00
R1543:Pcx UTSW 19 4602223 missense probably damaging 1.00
R1559:Pcx UTSW 19 4619086 missense probably damaging 1.00
R1607:Pcx UTSW 19 4603159 missense possibly damaging 0.89
R1833:Pcx UTSW 19 4619104 missense probably damaging 0.98
R1866:Pcx UTSW 19 4621221 missense possibly damaging 0.58
R2131:Pcx UTSW 19 4602551 missense probably benign 0.00
R2224:Pcx UTSW 19 4617998 missense possibly damaging 0.46
R2226:Pcx UTSW 19 4617998 missense possibly damaging 0.46
R2280:Pcx UTSW 19 4604543 missense probably damaging 1.00
R3950:Pcx UTSW 19 4617967 missense probably benign 0.00
R3952:Pcx UTSW 19 4617967 missense probably benign 0.00
R4205:Pcx UTSW 19 4619166 missense possibly damaging 0.95
R4409:Pcx UTSW 19 4610003 missense possibly damaging 0.65
R4670:Pcx UTSW 19 4619888 missense probably damaging 1.00
R4691:Pcx UTSW 19 4619477 missense probably damaging 0.99
R4728:Pcx UTSW 19 4603096 missense probably damaging 1.00
R4808:Pcx UTSW 19 4620928 missense probably benign 0.00
R5200:Pcx UTSW 19 4618504 missense probably damaging 1.00
R5454:Pcx UTSW 19 4602476 missense probably damaging 1.00
R5621:Pcx UTSW 19 4619167 missense possibly damaging 0.59
R5990:Pcx UTSW 19 4621266 missense probably damaging 1.00
R6519:Pcx UTSW 19 4602211 missense possibly damaging 0.64
R6526:Pcx UTSW 19 4604495 missense probably benign 0.44
R7202:Pcx UTSW 19 4602333 missense possibly damaging 0.47
R7423:Pcx UTSW 19 4621178 missense probably benign 0.00
R7473:Pcx UTSW 19 4619561 nonsense probably null
R7654:Pcx UTSW 19 4515669 splice site probably null
R7963:Pcx UTSW 19 4602006 missense probably damaging 1.00
R8272:Pcx UTSW 19 4601730 missense probably damaging 1.00
R8693:Pcx UTSW 19 4602011 missense probably damaging 1.00
R8781:Pcx UTSW 19 4620952 missense probably damaging 1.00
R8829:Pcx UTSW 19 4601940 missense probably damaging 1.00
R9084:Pcx UTSW 19 4619840 missense probably damaging 1.00
R9334:Pcx UTSW 19 4620504 missense probably benign 0.31
Z1176:Pcx UTSW 19 4619073 missense possibly damaging 0.82
Predicted Primers PCR Primer
(F):5'- ATACGGCTCCCAAATGCTATGC -3'
(R):5'- TCCTTCAAAGCCTTGGGATGG -3'

Sequencing Primer
(F):5'- CCAAATGCTATGCACAGCTTTGTG -3'
(R):5'- GGGATGGAAGTGCATCTCC -3'
Posted On 2014-10-02