Mutagenetix > Incidental Mutations

Incidental Mutation 'R2172:Ints5'

237589

Institutional Source

Beutler Lab

Gene Symbol

Ints5

Ensembl Gene

ENSMUSG00000116347

Gene Name

Synonyms

1110055N21Rik

MMRRC Submission

040174-MU

Accession Numbers

Is this an essential gene?

Possibly essential (E-score: 0.531) question?

Stock #

R2172 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

8888926-8895227 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

C to T at 8896282 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Threonine to Isoleucine at position 535 (T535I)

Ref Sequence

ENSEMBL: ENSMUSP00000093968 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000096246] [ENSMUST00000096249] [ENSMUST00000187504] [ENSMUST00000191089]

AlphaFold

no structure available at present

Predicted Effect

probably benign
Transcript: ENSMUST00000096246

SMART Domains

Protein: ENSMUSP00000093965
Gene: ENSMUSG00000071650

Domain	Start	End	E-Value	Type
signal peptide	1	32	N/A	INTRINSIC
low complexity region	157	169	N/A	INTRINSIC
Pfam:Gal_mutarotas_2	275	346	3.9e-24	PFAM
Pfam:Glyco_hydro_31	387	832	8.7e-136	PFAM
low complexity region	888	898	N/A	INTRINSIC

Predicted Effect

possibly damaging
Transcript: ENSMUST00000096249
AA Change: T535I

PolyPhen 2 Score 0.728 (Sensitivity: 0.86; Specificity: 0.92)

SMART Domains

Protein: ENSMUSP00000093968
Gene: ENSMUSG00000071652
AA Change: T535I

Domain	Start	End	E-Value	Type
low complexity region	7	25	N/A	INTRINSIC
Pfam:INTS5_N	29	252	1e-82	PFAM
low complexity region	254	267	N/A	INTRINSIC
Pfam:INTS5_C	289	998	2.2e-249	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000187504

SMART Domains

Protein: ENSMUSP00000139692
Gene: ENSMUSG00000096740

Domain	Start	End	E-Value	Type
Pfam:Lbh	1	101	2.5e-20	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000188635

Predicted Effect

probably benign
Transcript: ENSMUST00000191089

SMART Domains

Protein: ENSMUSP00000140564
Gene: ENSMUSG00000116347

Domain	Start	End	E-Value	Type
low complexity region	15	37	N/A	INTRINSIC

Coding Region Coverage

1x: 99.2%
3x: 98.7%
10x: 97.4%
20x: 95.4%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The Integrator complex is a complex that associates with the C-terminal domain of RNA polymerase II large subunit. This complex is brought to U1 and U2 small nuclear RNA genes, where it is involved in the transcription and processing of their transcripts. The protein encoded by this gene represents a subunit of the Integrator complex. [provided by RefSeq, Aug 2016]

Allele List at MGI

Other mutations in this stock

Total: 64 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Arap3	T	A	18: 37,990,560	E441V	probably damaging	Het
Arfip2	T	A	7: 105,637,988	D64V	probably damaging	Het
Atg9a	C	A	1: 75,185,685	R527L	probably damaging	Het
Atp1a1	T	G	3: 101,590,548	I308L	probably benign	Het
Bcan	T	A	3: 87,996,581	Y199F	probably damaging	Het
Bsn	T	C	9: 108,109,992		probably benign	Het
Ccdc158	A	T	5: 92,632,508	L902H	probably damaging	Het
Dnah7b	A	G	1: 46,124,512	Y492C	probably benign	Het
Dnah9	G	T	11: 66,072,779	H1783N	probably damaging	Het
Dpep2	A	G	8: 105,988,998	V320A	possibly damaging	Het
Dsc2	A	G	18: 20,045,502	Y282H	probably damaging	Het
Egfr	C	T	11: 16,911,562	P1114S	probably benign	Het
Fastkd1	A	G	2: 69,700,133	S560P	probably damaging	Het
Gm10696	T	G	3: 94,176,298	K69Q	possibly damaging	Het
Gm14295	G	A	2: 176,811,102	R795Q	possibly damaging	Het
Gpr155	C	T	2: 73,382,127	V51I	probably benign	Het
Gsap	G	A	5: 21,222,440		probably null	Het
Hecw1	T	A	13: 14,377,706	I103F	probably damaging	Het
Herc3	T	A	6: 58,887,437	N685K	probably damaging	Het
Hnrnph1	T	A	11: 50,382,816	D244E	probably benign	Het
Hydin	A	G	8: 110,582,049	E3989G	probably benign	Het
Ibsp	T	C	5: 104,310,430	Y278H	probably damaging	Het
Ift57	T	G	16: 49,759,340	N291K	probably benign	Het
Il15ra	A	G	2: 11,723,571	T149A	possibly damaging	Het
Jarid2	T	C	13: 44,902,539	L268P	probably damaging	Het
Klhdc7a	T	A	4: 139,965,810	T609S	probably benign	Het
Lrrc49	A	G	9: 60,602,682	V429A	probably benign	Het
Lsm3	T	C	6: 91,522,272	V87A	possibly damaging	Het
Man1c1	G	C	4: 134,703,438	P11R	probably damaging	Het
Map1a	G	T	2: 121,307,932	V2726L	probably damaging	Het
Marveld3	A	C	8: 109,961,846	S88A	probably benign	Het
Mcm9	T	C	10: 53,548,574	D640G	probably damaging	Het
Mettl4	A	G	17: 94,733,163	I399T	probably benign	Het
Mmp27	T	A	9: 7,577,378	L274*	probably null	Het
Nacc2	A	C	2: 26,060,223	D500E	probably benign	Het
Nprl3	T	A	11: 32,234,894	M372L	probably benign	Het
Olfr478	A	T	7: 108,031,467	I292N	probably damaging	Het
Otud7b	T	G	3: 96,153,520		probably null	Het
Pcx	G	A	19: 4,620,881	R1070H	probably benign	Het
Ptprq	C	T	10: 107,590,994	W1560*	probably null	Het
Puf60	A	T	15: 76,070,464	I520N	probably damaging	Het
Qars	C	T	9: 108,509,200	R143C	probably damaging	Het
Rfx3	G	A	19: 27,815,494	Q322*	probably null	Het
Samd14	G	T	11: 95,014,391	V10L	probably benign	Het
Setd2	G	A	9: 110,549,844	R909Q	probably benign	Het
Sh2d4a	T	C	8: 68,296,664	S117P	probably benign	Het
Sharpin	C	A	15: 76,350,666		probably benign	Het
Skor1	C	A	9: 63,145,122	A494S	possibly damaging	Het
Slc41a2	T	C	10: 83,283,774	T375A	probably benign	Het
Sparc	G	A	11: 55,395,801	Q324*	probably null	Het
Srebf1	T	C	11: 60,206,502	T171A	probably benign	Het
Srrd	A	G	5: 112,341,122	I54T	possibly damaging	Het
Tecpr1	G	T	5: 144,196,417	Q1072K	probably damaging	Het
Tecpr1	A	T	5: 144,211,456	V377E	probably benign	Het
Tln1	T	A	4: 43,545,721	H919L	probably benign	Het
Tm9sf3	C	T	19: 41,217,420	S516N	probably damaging	Het
Trpa1	T	A	1: 14,881,656	T940S	probably benign	Het
Trpv4	G	A	5: 114,644,710	R64C	probably damaging	Het
Tufm	A	G	7: 126,488,847	E174G	probably benign	Het
Urb2	A	G	8: 124,031,102	T1183A	probably damaging	Het
Virma	A	T	4: 11,527,843	M1245L	possibly damaging	Het
Vmn2r32	T	C	7: 7,474,615	Y259C	probably damaging	Het
Zfp329	A	G	7: 12,810,767	F277L	probably damaging	Het
Zfp683	C	T	4: 134,055,795	T190I	possibly damaging	Het

Other mutations in Ints5

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01448:Ints5	APN	19	8895487	missense	possibly damaging	0.93
IGL01915:Ints5	APN	19	8896993	missense	probably benign
IGL01993:Ints5	APN	19	8895465	missense	probably benign
IGL02264:Ints5	APN	19	8895712	missense	probably benign	0.02
IGL02367:Ints5	APN	19	8895595	missense	probably benign	0.06
IGL02955:Ints5	APN	19	8897650	missense	probably damaging	1.00
FR4449:Ints5	UTSW	19	8897230	missense	probably benign	0.10
R0348:Ints5	UTSW	19	8895750	missense	probably damaging	0.97
R0379:Ints5	UTSW	19	8897133	missense	possibly damaging	0.90
R0617:Ints5	UTSW	19	8896019	missense	probably damaging	1.00
R1954:Ints5	UTSW	19	8894896	missense	probably damaging	1.00
R2370:Ints5	UTSW	19	8896779	missense	probably benign
R3116:Ints5	UTSW	19	8894772	missense	possibly damaging	0.84
R4395:Ints5	UTSW	19	8896444	missense	probably damaging	0.96
R5390:Ints5	UTSW	19	8896567	missense	possibly damaging	0.73
R6868:Ints5	UTSW	19	8897386	missense	probably damaging	1.00
R7133:Ints5	UTSW	19	8895559	missense	probably damaging	1.00
R7685:Ints5	UTSW	19	8896804	missense	probably benign	0.10
R7999:Ints5	UTSW	19	8897043	missense	probably benign
R8024:Ints5	UTSW	19	8896140	missense	probably damaging	1.00
R8296:Ints5	UTSW	19	8895120	missense	probably damaging	1.00
R8672:Ints5	UTSW	19	8896006	missense	probably damaging	1.00
R9027:Ints5	UTSW	19	8895958	missense	possibly damaging	0.77
X0066:Ints5	UTSW	19	8896231	missense	probably damaging	1.00
Z1177:Ints5	UTSW	19	8894935	missense	probably benign	0.31
Z1177:Ints5	UTSW	19	8894973	missense	probably damaging	0.99

Predicted Primers

PCR Primer
(F):5'- ACCATGTTGGAGAACTGTGTGG -3'
(R):5'- CTTCCTCCTCTGGGTGTAGTAG -3'

Sequencing Primer
(F):5'- CTGTGTGGAGAGACATTACGGC -3'
(R):5'- CAGATCAGCCAGGTGAGCTG -3'

Posted On

2014-10-02