Mutagenetix > Incidental Mutations

Incidental Mutation 'R2172:Rfx3'

237590

Institutional Source

Beutler Lab

Gene Symbol

Rfx3

Ensembl Gene

ENSMUSG00000040929

Gene Name

regulatory factor X, 3 (influences HLA class II expression)

Synonyms

C230093O12Rik, MRFX3

MMRRC Submission

040174-MU

Accession Numbers

Is this an essential gene?

Essential (E-score: 1.000) question?

Stock #

R2172 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

27761721-28011166 bp(-) (GRCm38)

Type of Mutation

nonsense

DNA Base Change (assembly)

G to A at 27815494 bp

Zygosity

Heterozygous

Amino Acid Change

Glutamine to Stop codon at position 322 (Q322*)

Ref Sequence

ENSEMBL: ENSMUSP00000133461 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000046898] [ENSMUST00000165566] [ENSMUST00000172907] [ENSMUST00000173863] [ENSMUST00000174850]

Predicted Effect

probably null
Transcript: ENSMUST00000046898
AA Change: Q297*

SMART Domains

Protein: ENSMUSP00000038760
Gene: ENSMUSG00000040929
AA Change: Q297*

Domain	Start	End	E-Value	Type
Pfam:RFX1_trans_act	1	140	6.3e-58	PFAM
Pfam:RFX_DNA_binding	150	235	6.9e-41	PFAM
low complexity region	274	283	N/A	INTRINSIC
internal_repeat_1	326	414	1.39e-5	PROSPERO
internal_repeat_1	439	527	1.39e-5	PROSPERO
low complexity region	649	664	N/A	INTRINSIC

Predicted Effect

probably null
Transcript: ENSMUST00000165566
AA Change: Q322*

SMART Domains

Protein: ENSMUSP00000126313
Gene: ENSMUSG00000040929
AA Change: Q322*

Domain	Start	End	E-Value	Type
Pfam:RFX1_trans_act	4	138	9.7e-38	PFAM
Pfam:RFX_DNA_binding	181	258	6.2e-36	PFAM
low complexity region	299	308	N/A	INTRINSIC
internal_repeat_1	351	439	1.82e-5	PROSPERO
internal_repeat_1	464	552	1.82e-5	PROSPERO
low complexity region	674	689	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000172498

Predicted Effect

probably null
Transcript: ENSMUST00000172907
AA Change: Q322*

SMART Domains

Protein: ENSMUSP00000134141
Gene: ENSMUSG00000040929
AA Change: Q322*

Domain	Start	End	E-Value	Type
Pfam:RFX1_trans_act	1	140	9.4e-58	PFAM
Pfam:RFX_DNA_binding	175	260	5.2e-41	PFAM
low complexity region	299	308	N/A	INTRINSIC
internal_repeat_1	351	439	1.82e-5	PROSPERO
internal_repeat_1	464	552	1.82e-5	PROSPERO
low complexity region	674	689	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000173161

Predicted Effect

probably null
Transcript: ENSMUST00000173863
AA Change: Q308*

SMART Domains

Protein: ENSMUSP00000133367
Gene: ENSMUSG00000040929
AA Change: Q308*

Domain	Start	End	E-Value	Type
Pfam:RFX1_trans_act	1	140	3.3e-58	PFAM
Pfam:RFX_DNA_binding	175	246	3.7e-24	PFAM
low complexity region	285	294	N/A	INTRINSIC

Predicted Effect

probably null
Transcript: ENSMUST00000174850
AA Change: Q322*

SMART Domains

Protein: ENSMUSP00000133461
Gene: ENSMUSG00000040929
AA Change: Q322*

Domain	Start	End	E-Value	Type
Pfam:RFX1_trans_act	1	140	9.4e-58	PFAM
Pfam:RFX_DNA_binding	175	260	5.2e-41	PFAM
low complexity region	299	308	N/A	INTRINSIC
internal_repeat_1	351	439	1.82e-5	PROSPERO
internal_repeat_1	464	552	1.82e-5	PROSPERO
low complexity region	674	689	N/A	INTRINSIC

Coding Region Coverage

1x: 99.2%
3x: 98.7%
10x: 97.4%
20x: 95.4%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the regulatory factor X gene family, which encodes transcription factors that contain a highly-conserved winged helix DNA binding domain. The protein encoded by this gene is structurally related to regulatory factors X1, X2, X4, and X5. It is a transcriptional activator that can bind DNA as a monomer or as a heterodimer with other RFX family members. Multiple transcript variants encoding different isoforms have been described for this gene. [provided by RefSeq, Aug 2013]
PHENOTYPE: Homozygous null mice display embryonic and perinatal lethality, impaired development of cilia on the embryonic node, abnormal left-right patterning, meso- and dextrocardia, and situs inversus in surviving adults. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 64 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Arap3	T	A	18: 37,990,560	E441V	probably damaging	Het
Arfip2	T	A	7: 105,637,988	D64V	probably damaging	Het
Atg9a	C	A	1: 75,185,685	R527L	probably damaging	Het
Atp1a1	T	G	3: 101,590,548	I308L	probably benign	Het
Bcan	T	A	3: 87,996,581	Y199F	probably damaging	Het
Bsn	T	C	9: 108,109,992		probably benign	Het
Ccdc158	A	T	5: 92,632,508	L902H	probably damaging	Het
Dnah7b	A	G	1: 46,124,512	Y492C	probably benign	Het
Dnah9	G	T	11: 66,072,779	H1783N	probably damaging	Het
Dpep2	A	G	8: 105,988,998	V320A	possibly damaging	Het
Dsc2	A	G	18: 20,045,502	Y282H	probably damaging	Het
Egfr	C	T	11: 16,911,562	P1114S	probably benign	Het
Fastkd1	A	G	2: 69,700,133	S560P	probably damaging	Het
Gm10696	T	G	3: 94,176,298	K69Q	possibly damaging	Het
Gm14295	G	A	2: 176,811,102	R795Q	possibly damaging	Het
Gpr155	C	T	2: 73,382,127	V51I	probably benign	Het
Gsap	G	A	5: 21,222,440		probably null	Het
Hecw1	T	A	13: 14,377,706	I103F	probably damaging	Het
Herc3	T	A	6: 58,887,437	N685K	probably damaging	Het
Hnrnph1	T	A	11: 50,382,816	D244E	probably benign	Het
Hydin	A	G	8: 110,582,049	E3989G	probably benign	Het
Ibsp	T	C	5: 104,310,430	Y278H	probably damaging	Het
Ift57	T	G	16: 49,759,340	N291K	probably benign	Het
Il15ra	A	G	2: 11,723,571	T149A	possibly damaging	Het
Ints5	C	T	19: 8,896,282	T535I	possibly damaging	Het
Jarid2	T	C	13: 44,902,539	L268P	probably damaging	Het
Klhdc7a	T	A	4: 139,965,810	T609S	probably benign	Het
Lrrc49	A	G	9: 60,602,682	V429A	probably benign	Het
Lsm3	T	C	6: 91,522,272	V87A	possibly damaging	Het
Man1c1	G	C	4: 134,703,438	P11R	probably damaging	Het
Map1a	G	T	2: 121,307,932	V2726L	probably damaging	Het
Marveld3	A	C	8: 109,961,846	S88A	probably benign	Het
Mcm9	T	C	10: 53,548,574	D640G	probably damaging	Het
Mettl4	A	G	17: 94,733,163	I399T	probably benign	Het
Mmp27	T	A	9: 7,577,378	L274*	probably null	Het
Nacc2	A	C	2: 26,060,223	D500E	probably benign	Het
Nprl3	T	A	11: 32,234,894	M372L	probably benign	Het
Olfr478	A	T	7: 108,031,467	I292N	probably damaging	Het
Otud7b	T	G	3: 96,153,520		probably null	Het
Pcx	G	A	19: 4,620,881	R1070H	probably benign	Het
Ptprq	C	T	10: 107,590,994	W1560*	probably null	Het
Puf60	A	T	15: 76,070,464	I520N	probably damaging	Het
Qars	C	T	9: 108,509,200	R143C	probably damaging	Het
Samd14	G	T	11: 95,014,391	V10L	probably benign	Het
Setd2	G	A	9: 110,549,844	R909Q	probably benign	Het
Sh2d4a	T	C	8: 68,296,664	S117P	probably benign	Het
Sharpin	C	A	15: 76,350,666		probably benign	Het
Skor1	C	A	9: 63,145,122	A494S	possibly damaging	Het
Slc41a2	T	C	10: 83,283,774	T375A	probably benign	Het
Sparc	G	A	11: 55,395,801	Q324*	probably null	Het
Srebf1	T	C	11: 60,206,502	T171A	probably benign	Het
Srrd	A	G	5: 112,341,122	I54T	possibly damaging	Het
Tecpr1	G	T	5: 144,196,417	Q1072K	probably damaging	Het
Tecpr1	A	T	5: 144,211,456	V377E	probably benign	Het
Tln1	T	A	4: 43,545,721	H919L	probably benign	Het
Tm9sf3	C	T	19: 41,217,420	S516N	probably damaging	Het
Trpa1	T	A	1: 14,881,656	T940S	probably benign	Het
Trpv4	G	A	5: 114,644,710	R64C	probably damaging	Het
Tufm	A	G	7: 126,488,847	E174G	probably benign	Het
Urb2	A	G	8: 124,031,102	T1183A	probably damaging	Het
Virma	A	T	4: 11,527,843	M1245L	possibly damaging	Het
Vmn2r32	T	C	7: 7,474,615	Y259C	probably damaging	Het
Zfp329	A	G	7: 12,810,767	F277L	probably damaging	Het
Zfp683	C	T	4: 134,055,795	T190I	possibly damaging	Het

Other mutations in Rfx3

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00548:Rfx3	APN	19	27806186	critical splice donor site	probably null
IGL00588:Rfx3	APN	19	27826076	nonsense	probably null
IGL01408:Rfx3	APN	19	27768650	missense	probably benign	0.04
IGL01937:Rfx3	APN	19	27830729	missense	probably damaging	1.00
IGL02668:Rfx3	APN	19	27815614	splice site	probably benign
IGL02679:Rfx3	APN	19	27849737	missense	possibly damaging	0.95
R0267:Rfx3	UTSW	19	27793788	missense	probably benign	0.00
R0336:Rfx3	UTSW	19	27806262	missense	probably benign	0.00
R0838:Rfx3	UTSW	19	27849967	missense	possibly damaging	0.92
R0967:Rfx3	UTSW	19	27806351	splice site	probably benign
R1102:Rfx3	UTSW	19	27867600	missense	possibly damaging	0.51
R1507:Rfx3	UTSW	19	27768513	missense	probably benign	0.00
R2844:Rfx3	UTSW	19	27806786	splice site	probably benign
R2960:Rfx3	UTSW	19	27900811	nonsense	probably null
R4291:Rfx3	UTSW	19	27800232	missense	probably damaging	1.00
R4952:Rfx3	UTSW	19	27830672	missense	probably damaging	1.00
R5198:Rfx3	UTSW	19	27830776	missense	probably damaging	1.00
R5451:Rfx3	UTSW	19	27849959	missense	probably damaging	1.00
R5590:Rfx3	UTSW	19	27802380	critical splice donor site	probably null
R5641:Rfx3	UTSW	19	27793608	splice site	probably null
R5663:Rfx3	UTSW	19	27793617	missense	probably damaging	1.00
R5899:Rfx3	UTSW	19	27830765	missense	probably damaging	1.00
R6049:Rfx3	UTSW	19	27802395	missense	probably damaging	0.99
R6368:Rfx3	UTSW	19	27768609	missense	possibly damaging	0.92
R7131:Rfx3	UTSW	19	27768628	nonsense	probably null
R7273:Rfx3	UTSW	19	27802458	missense	probably damaging	1.00
R7593:Rfx3	UTSW	19	27849739	missense	probably benign	0.00
R7814:Rfx3	UTSW	19	27826070	missense	probably benign	0.01
R7815:Rfx3	UTSW	19	27826048	missense	probably benign	0.00
Z1088:Rfx3	UTSW	19	27837450	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- GGCAGATGCATTCAAGATTCC -3'
(R):5'- GAACGCCTTAAAAGATTGGGTAGTG -3'

Sequencing Primer
(F):5'- CAGATGCATTCAAGATTCCATATAGC -3'
(R):5'- GATTGGGTAGTGTAATAAAGCAAGG -3'

Posted On

2014-10-02