Incidental Mutation 'R2173:Corin'
ID237612
Institutional Source Beutler Lab
Gene Symbol Corin
Ensembl Gene ENSMUSG00000005220
Gene Namecorin
SynonymsLrp4
MMRRC Submission 040175-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.153) question?
Stock #R2173 (G1)
Quality Score225
Status Validated
Chromosome5
Chromosomal Location72300025-72504473 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 72504079 bp
ZygosityHeterozygous
Amino Acid Change Cysteine to Serine at position 24 (C24S)
Ref Sequence ENSEMBL: ENSMUSP00000005352 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000005352] [ENSMUST00000167460] [ENSMUST00000175766] [ENSMUST00000176974] [ENSMUST00000177290]
Predicted Effect probably benign
Transcript: ENSMUST00000005352
AA Change: C24S

PolyPhen 2 Score 0.008 (Sensitivity: 0.96; Specificity: 0.76)
SMART Domains Protein: ENSMUSP00000005352
Gene: ENSMUSG00000005220
AA Change: C24S

DomainStartEndE-ValueType
low complexity region 3 15 N/A INTRINSIC
transmembrane domain 113 135 N/A INTRINSIC
FRI 205 318 6.15e-11 SMART
LDLa 336 372 1.31e-8 SMART
LDLa 373 408 1.5e-8 SMART
LDLa 409 447 5.47e-11 SMART
LDLa 448 484 1.22e-8 SMART
low complexity region 508 521 N/A INTRINSIC
FRI 522 643 2.75e-31 SMART
LDLa 647 684 2.19e-10 SMART
LDLa 685 722 1.76e-5 SMART
LDLa 723 759 4.18e-7 SMART
SR 758 853 3.99e-10 SMART
Tryp_SPc 868 1097 5.45e-76 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000167460
SMART Domains Protein: ENSMUSP00000127389
Gene: ENSMUSG00000005220

DomainStartEndE-ValueType
transmembrane domain 47 69 N/A INTRINSIC
FRI 139 252 6.15e-11 SMART
LDLa 270 306 1.31e-8 SMART
LDLa 307 342 1.5e-8 SMART
LDLa 343 381 5.47e-11 SMART
LDLa 382 418 1.22e-8 SMART
low complexity region 442 455 N/A INTRINSIC
FRI 456 577 2.75e-31 SMART
LDLa 581 618 2.19e-10 SMART
LDLa 619 656 1.76e-5 SMART
LDLa 657 693 4.18e-7 SMART
SR 692 787 3.99e-10 SMART
Tryp_SPc 802 1031 5.45e-76 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000175766
SMART Domains Protein: ENSMUSP00000135889
Gene: ENSMUSG00000005220

DomainStartEndE-ValueType
transmembrane domain 45 67 N/A INTRINSIC
FRI 137 250 6.15e-11 SMART
LDLa 268 304 1.31e-8 SMART
LDLa 305 343 2.07e-11 SMART
low complexity region 367 380 N/A INTRINSIC
FRI 381 502 2.75e-31 SMART
LDLa 506 543 2.19e-10 SMART
LDLa 544 581 1.76e-5 SMART
LDLa 582 618 4.18e-7 SMART
SR 617 712 3.99e-10 SMART
Tryp_SPc 727 956 5.45e-76 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000176974
SMART Domains Protein: ENSMUSP00000135722
Gene: ENSMUSG00000005220

DomainStartEndE-ValueType
transmembrane domain 47 69 N/A INTRINSIC
FRI 139 252 6.15e-11 SMART
LDLa 270 306 1.31e-8 SMART
LDLa 307 344 3.86e-11 SMART
LDLa 345 381 1.22e-8 SMART
low complexity region 405 418 N/A INTRINSIC
FRI 419 540 2.75e-31 SMART
LDLa 544 581 2.19e-10 SMART
LDLa 582 619 1.76e-5 SMART
LDLa 620 656 4.18e-7 SMART
SR 655 750 3.99e-10 SMART
Tryp_SPc 765 994 5.45e-76 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000177290
SMART Domains Protein: ENSMUSP00000135511
Gene: ENSMUSG00000005220

DomainStartEndE-ValueType
transmembrane domain 47 69 N/A INTRINSIC
FRI 72 185 6.15e-11 SMART
LDLa 203 239 1.31e-8 SMART
LDLa 240 275 1.5e-8 SMART
LDLa 276 314 5.47e-11 SMART
LDLa 315 351 1.22e-8 SMART
low complexity region 375 388 N/A INTRINSIC
FRI 389 510 2.75e-31 SMART
LDLa 514 551 2.19e-10 SMART
LDLa 552 589 1.76e-5 SMART
LDLa 590 626 4.18e-7 SMART
SR 625 720 3.99e-10 SMART
Tryp_SPc 735 964 5.45e-76 SMART
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.6%
Validation Efficiency 97% (66/68)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the type II transmembrane serine protease class of the trypsin superfamily. Members of this family are composed of multiple structurally distinct domains. The encoded protein converts pro-atrial natriuretic peptide to biologically active atrial natriuretic peptide, a cardiac hormone that regulates blood volume and pressure. This protein may also function as a pro-brain-type natriuretic peptide convertase. Multiple alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jun 2013]
PHENOTYPE: Homozygous null mice display hypertension that is enhanced by high-salt diet and pregnancy, increased body weight, and cardiac hypertrophy. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 64 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A930017K11Rik A C 17: 25,948,487 H25Q probably damaging Het
Alpk1 T A 3: 127,683,590 H273L probably damaging Het
Alpk3 A G 7: 81,076,900 Y111C probably damaging Het
Anapc2 T G 2: 25,273,276 V175G probably benign Het
Arhgap30 T C 1: 171,407,767 S570P probably damaging Het
AU040320 T C 4: 126,792,276 L215P probably benign Het
Ccdc59 A T 10: 105,841,527 K9M possibly damaging Het
Ccdc65 A G 15: 98,721,033 N298D probably benign Het
Cfap70 T A 14: 20,408,562 N727Y probably benign Het
Clcn7 A G 17: 25,145,609 H63R probably benign Het
Cyp1a2 A G 9: 57,677,515 W419R probably damaging Het
Dlgap4 C A 2: 156,762,812 A256D probably damaging Het
Eif4enif1 A G 11: 3,242,367 probably null Het
Eri2 A G 7: 119,786,543 V245A possibly damaging Het
Erich6b T C 14: 75,658,892 F73L probably benign Het
Fam110a A G 2: 151,970,509 C114R probably damaging Het
Fam149a T C 8: 45,353,954 D288G probably damaging Het
Fam171a1 T A 2: 3,225,619 Y596* probably null Het
Fsd1 A G 17: 55,991,223 T183A possibly damaging Het
Fut10 T A 8: 31,236,131 Y305N probably damaging Het
Ganab A T 19: 8,902,260 probably benign Het
Gm9922 G T 14: 101,729,576 probably benign Het
Gp9 A G 6: 87,779,053 T17A probably benign Het
Gxylt2 T C 6: 100,798,154 Y345H probably damaging Het
Herc2 A G 7: 56,185,951 H3269R probably benign Het
Hpx A T 7: 105,592,083 S374T probably benign Het
Hspa5 T C 2: 34,774,662 V376A probably damaging Het
Hyi T C 4: 118,362,184 probably benign Het
Impdh2 G A 9: 108,565,394 probably null Het
Kremen2 A C 17: 23,742,796 W246G probably damaging Het
Krt83 A G 15: 101,487,937 V259A probably damaging Het
L3mbtl4 A T 17: 68,587,193 H398L probably damaging Het
Lama5 C A 2: 180,196,242 V894L probably benign Het
Maml2 A G 9: 13,621,616 probably benign Het
Nup153 A T 13: 46,701,600 probably benign Het
Olfr1387 G T 11: 49,460,140 V154L probably benign Het
Olfr177 A G 16: 58,872,619 F177S probably damaging Het
Olfr824 G A 10: 130,126,503 P185S probably benign Het
Olfr918 T C 9: 38,672,944 I180V probably benign Het
Olfr981 T G 9: 40,023,254 I287S probably damaging Het
Otof C T 5: 30,386,374 R582H probably damaging Het
Otud4 T C 8: 79,668,464 S543P probably damaging Het
Pde6a A G 18: 61,254,382 D448G probably damaging Het
Phgdh A G 3: 98,315,111 V388A probably benign Het
Plin3 G T 17: 56,279,891 D385E possibly damaging Het
Polg G T 7: 79,455,593 D734E probably damaging Het
Pomt1 T C 2: 32,250,900 Y515H probably damaging Het
Pwwp2a G A 11: 43,682,486 A132T probably benign Het
Rbm6 A T 9: 107,852,191 F419L possibly damaging Het
Rfx5 A G 3: 94,956,716 probably null Het
Rnf135 G A 11: 80,189,240 S119N probably benign Het
Scfd1 T A 12: 51,387,079 D51E probably benign Het
Smox A T 2: 131,512,024 E5D possibly damaging Het
Srpk2 T C 5: 23,518,615 probably null Het
Syne2 T A 12: 76,100,989 probably benign Het
Tcf20 A G 15: 82,854,692 S853P possibly damaging Het
Tmem131l A G 3: 83,926,145 F804L probably damaging Het
Ttll8 A G 15: 88,914,597 L645P probably damaging Het
Ubr3 T A 2: 69,897,399 H35Q probably benign Het
Uck1 GCCAACACC GCC 2: 32,256,076 probably benign Het
Vmn2r70 A T 7: 85,565,082 H287Q probably benign Het
Vps26a A T 10: 62,468,392 I150N probably damaging Het
Zfp605 G A 5: 110,127,457 R147H probably benign Het
Zfyve16 A G 13: 92,495,088 M1333T probably damaging Het
Other mutations in Corin
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00557:Corin APN 5 72304888 missense probably damaging 1.00
IGL01114:Corin APN 5 72305011 missense probably damaging 1.00
IGL01351:Corin APN 5 72338991 missense probably damaging 1.00
IGL01516:Corin APN 5 72454487 nonsense probably null
IGL01785:Corin APN 5 72339876 missense probably damaging 1.00
IGL01786:Corin APN 5 72339876 missense probably damaging 1.00
IGL01845:Corin APN 5 72353939 missense probably damaging 1.00
IGL02097:Corin APN 5 72372146 missense probably damaging 1.00
IGL02629:Corin APN 5 72332673 missense probably damaging 1.00
IGL03085:Corin APN 5 72353930 missense probably damaging 1.00
IGL03120:Corin APN 5 72360689 missense probably damaging 1.00
IGL03150:Corin APN 5 72302858 missense probably damaging 1.00
IGL03183:Corin APN 5 72301586 missense probably damaging 0.99
IGL03185:Corin APN 5 72332781 missense probably damaging 1.00
IGL03408:Corin APN 5 72342961 missense probably benign 0.40
alpaca UTSW 5 72503952 missense possibly damaging 0.85
R0078:Corin UTSW 5 72454473 missense possibly damaging 0.77
R0724:Corin UTSW 5 72332795 splice site probably benign
R1065:Corin UTSW 5 72301650 nonsense probably null
R1301:Corin UTSW 5 72304933 missense possibly damaging 0.81
R1466:Corin UTSW 5 72302790 critical splice donor site probably null
R1466:Corin UTSW 5 72302790 critical splice donor site probably null
R1520:Corin UTSW 5 72330895 missense probably damaging 1.00
R1584:Corin UTSW 5 72302790 critical splice donor site probably null
R1617:Corin UTSW 5 72503952 missense possibly damaging 0.85
R1912:Corin UTSW 5 72358403 missense probably damaging 1.00
R2059:Corin UTSW 5 72316051 missense possibly damaging 0.76
R2242:Corin UTSW 5 72332711 missense probably damaging 1.00
R2373:Corin UTSW 5 72339038 missense probably damaging 1.00
R2850:Corin UTSW 5 72304955 missense probably damaging 1.00
R3683:Corin UTSW 5 72330855 missense probably damaging 1.00
R3684:Corin UTSW 5 72330855 missense probably damaging 1.00
R3790:Corin UTSW 5 72435298 missense probably benign 0.38
R3847:Corin UTSW 5 72422165 missense probably benign 0.13
R3926:Corin UTSW 5 72372130 missense probably damaging 1.00
R3939:Corin UTSW 5 72339879 missense possibly damaging 0.80
R3945:Corin UTSW 5 72358424 missense probably damaging 1.00
R4079:Corin UTSW 5 72503883 missense probably benign 0.03
R4224:Corin UTSW 5 72343108 missense probably damaging 1.00
R4473:Corin UTSW 5 72339057 missense probably damaging 1.00
R4585:Corin UTSW 5 72329699 missense probably damaging 1.00
R4586:Corin UTSW 5 72329699 missense probably damaging 1.00
R4849:Corin UTSW 5 72302835 missense probably damaging 1.00
R4926:Corin UTSW 5 72372182 missense probably damaging 1.00
R5080:Corin UTSW 5 72353851 intron probably benign
R5138:Corin UTSW 5 72339059 missense probably damaging 1.00
R5262:Corin UTSW 5 72304955 missense probably damaging 1.00
R5268:Corin UTSW 5 72343019 missense probably damaging 1.00
R5302:Corin UTSW 5 72316098 missense probably benign 0.07
R5307:Corin UTSW 5 72356978 missense probably damaging 1.00
R5324:Corin UTSW 5 72435257 missense probably damaging 1.00
R5352:Corin UTSW 5 72305033 missense probably benign 0.04
R5373:Corin UTSW 5 72304953 missense probably damaging 1.00
R5374:Corin UTSW 5 72304953 missense probably damaging 1.00
R5484:Corin UTSW 5 72358484 missense probably benign 0.15
R5502:Corin UTSW 5 72316106 nonsense probably null
R5544:Corin UTSW 5 72305014 nonsense probably null
R5682:Corin UTSW 5 72422154 missense possibly damaging 0.85
R5818:Corin UTSW 5 72435395 missense probably benign 0.00
R5992:Corin UTSW 5 72316389 missense probably benign 0.01
R6115:Corin UTSW 5 72360729 missense probably damaging 1.00
R6181:Corin UTSW 5 72372096 critical splice donor site probably null
R6317:Corin UTSW 5 72339045 missense probably damaging 1.00
R7053:Corin UTSW 5 72301527 missense probably benign 0.28
R7242:Corin UTSW 5 72305055 missense probably benign 0.14
R7452:Corin UTSW 5 72435247 missense possibly damaging 0.94
R7783:Corin UTSW 5 72301624 missense probably benign 0.26
R7903:Corin UTSW 5 72301500 missense probably benign 0.00
R8007:Corin UTSW 5 72316103 missense probably damaging 0.96
R8125:Corin UTSW 5 72358463 missense probably damaging 0.96
R8215:Corin UTSW 5 72305018 missense probably damaging 1.00
R8251:Corin UTSW 5 72356926 missense probably damaging 1.00
Z1177:Corin UTSW 5 72454493 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- AAGCAATCCTTCCAGCTGCC -3'
(R):5'- ATATGTTCACGAAACGGCCCC -3'

Sequencing Primer
(F):5'- CGGGAGCCTGGAACTTG -3'
(R):5'- GGTAAGATCCACCCTCCTCG -3'
Posted On2014-10-02