Incidental Mutation 'R2173:Olfr918'
ID237626
Institutional Source Beutler Lab
Gene Symbol Olfr918
Ensembl Gene ENSMUSG00000046150
Gene Nameolfactory receptor 918
SynonymsGA_x6K02T2PVTD-32375756-32374818, MOR164-3
MMRRC Submission 040175-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.235) question?
Stock #R2173 (G1)
Quality Score225
Status Validated
Chromosome9
Chromosomal Location38669861-38674601 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 38672944 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Valine at position 180 (I180V)
Ref Sequence ENSEMBL: ENSMUSP00000057210 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000055099] [ENSMUST00000215461]
Predicted Effect probably benign
Transcript: ENSMUST00000055099
AA Change: I180V

PolyPhen 2 Score 0.025 (Sensitivity: 0.95; Specificity: 0.81)
SMART Domains Protein: ENSMUSP00000057210
Gene: ENSMUSG00000046150
AA Change: I180V

DomainStartEndE-ValueType
transmembrane domain 9 31 N/A INTRINSIC
Pfam:7tm_4 44 319 6.5e-48 PFAM
Pfam:7tm_1 54 301 3.9e-22 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000213750
Predicted Effect probably benign
Transcript: ENSMUST00000215461
AA Change: I167V

PolyPhen 2 Score 0.008 (Sensitivity: 0.96; Specificity: 0.76)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000216579
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.6%
Validation Efficiency 97% (66/68)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 64 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A930017K11Rik A C 17: 25,948,487 H25Q probably damaging Het
Alpk1 T A 3: 127,683,590 H273L probably damaging Het
Alpk3 A G 7: 81,076,900 Y111C probably damaging Het
Anapc2 T G 2: 25,273,276 V175G probably benign Het
Arhgap30 T C 1: 171,407,767 S570P probably damaging Het
AU040320 T C 4: 126,792,276 L215P probably benign Het
Ccdc59 A T 10: 105,841,527 K9M possibly damaging Het
Ccdc65 A G 15: 98,721,033 N298D probably benign Het
Cfap70 T A 14: 20,408,562 N727Y probably benign Het
Clcn7 A G 17: 25,145,609 H63R probably benign Het
Corin A T 5: 72,504,079 C24S probably benign Het
Cyp1a2 A G 9: 57,677,515 W419R probably damaging Het
Dlgap4 C A 2: 156,762,812 A256D probably damaging Het
Eif4enif1 A G 11: 3,242,367 probably null Het
Eri2 A G 7: 119,786,543 V245A possibly damaging Het
Erich6b T C 14: 75,658,892 F73L probably benign Het
Fam110a A G 2: 151,970,509 C114R probably damaging Het
Fam149a T C 8: 45,353,954 D288G probably damaging Het
Fam171a1 T A 2: 3,225,619 Y596* probably null Het
Fsd1 A G 17: 55,991,223 T183A possibly damaging Het
Fut10 T A 8: 31,236,131 Y305N probably damaging Het
Ganab A T 19: 8,902,260 probably benign Het
Gm9922 G T 14: 101,729,576 probably benign Het
Gp9 A G 6: 87,779,053 T17A probably benign Het
Gxylt2 T C 6: 100,798,154 Y345H probably damaging Het
Herc2 A G 7: 56,185,951 H3269R probably benign Het
Hpx A T 7: 105,592,083 S374T probably benign Het
Hspa5 T C 2: 34,774,662 V376A probably damaging Het
Hyi T C 4: 118,362,184 probably benign Het
Impdh2 G A 9: 108,565,394 probably null Het
Kremen2 A C 17: 23,742,796 W246G probably damaging Het
Krt83 A G 15: 101,487,937 V259A probably damaging Het
L3mbtl4 A T 17: 68,587,193 H398L probably damaging Het
Lama5 C A 2: 180,196,242 V894L probably benign Het
Maml2 A G 9: 13,621,616 probably benign Het
Nup153 A T 13: 46,701,600 probably benign Het
Olfr1387 G T 11: 49,460,140 V154L probably benign Het
Olfr177 A G 16: 58,872,619 F177S probably damaging Het
Olfr824 G A 10: 130,126,503 P185S probably benign Het
Olfr981 T G 9: 40,023,254 I287S probably damaging Het
Otof C T 5: 30,386,374 R582H probably damaging Het
Otud4 T C 8: 79,668,464 S543P probably damaging Het
Pde6a A G 18: 61,254,382 D448G probably damaging Het
Phgdh A G 3: 98,315,111 V388A probably benign Het
Plin3 G T 17: 56,279,891 D385E possibly damaging Het
Polg G T 7: 79,455,593 D734E probably damaging Het
Pomt1 T C 2: 32,250,900 Y515H probably damaging Het
Pwwp2a G A 11: 43,682,486 A132T probably benign Het
Rbm6 A T 9: 107,852,191 F419L possibly damaging Het
Rfx5 A G 3: 94,956,716 probably null Het
Rnf135 G A 11: 80,189,240 S119N probably benign Het
Scfd1 T A 12: 51,387,079 D51E probably benign Het
Smox A T 2: 131,512,024 E5D possibly damaging Het
Srpk2 T C 5: 23,518,615 probably null Het
Syne2 T A 12: 76,100,989 probably benign Het
Tcf20 A G 15: 82,854,692 S853P possibly damaging Het
Tmem131l A G 3: 83,926,145 F804L probably damaging Het
Ttll8 A G 15: 88,914,597 L645P probably damaging Het
Ubr3 T A 2: 69,897,399 H35Q probably benign Het
Uck1 GCCAACACC GCC 2: 32,256,076 probably benign Het
Vmn2r70 A T 7: 85,565,082 H287Q probably benign Het
Vps26a A T 10: 62,468,392 I150N probably damaging Het
Zfp605 G A 5: 110,127,457 R147H probably benign Het
Zfyve16 A G 13: 92,495,088 M1333T probably damaging Het
Other mutations in Olfr918
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00958:Olfr918 APN 9 38673024 missense probably benign 0.01
IGL01388:Olfr918 APN 9 38673083 nonsense probably null
IGL01516:Olfr918 APN 9 38672863 missense probably benign 0.09
IGL02121:Olfr918 APN 9 38673415 missense probably damaging 0.98
IGL02209:Olfr918 APN 9 38673046 missense possibly damaging 0.84
IGL02256:Olfr918 APN 9 38673480 start codon destroyed probably null
IGL02517:Olfr918 APN 9 38672913 missense probably damaging 1.00
IGL02648:Olfr918 APN 9 38673016 missense probably benign
IGL02747:Olfr918 APN 9 38673084 missense probably benign 0.11
IGL02971:Olfr918 APN 9 38673268 missense probably damaging 0.96
E0370:Olfr918 UTSW 9 38672561 missense probably damaging 0.99
R0616:Olfr918 UTSW 9 38673480 start codon destroyed probably null
R2989:Olfr918 UTSW 9 38672535 missense probably benign
R3430:Olfr918 UTSW 9 38673139 missense probably damaging 1.00
R3809:Olfr918 UTSW 9 38672863 missense probably benign 0.09
R4688:Olfr918 UTSW 9 38673363 missense probably damaging 1.00
R4702:Olfr918 UTSW 9 38673480 start codon destroyed probably null
R5548:Olfr918 UTSW 9 38673304 missense probably benign 0.00
R5590:Olfr918 UTSW 9 38672965 missense probably damaging 1.00
R6082:Olfr918 UTSW 9 38672570 missense probably damaging 1.00
R6214:Olfr918 UTSW 9 38673214 missense probably benign 0.13
R6215:Olfr918 UTSW 9 38673214 missense probably benign 0.13
R6893:Olfr918 UTSW 9 38673059 missense possibly damaging 0.95
R7215:Olfr918 UTSW 9 38673447 missense probably benign 0.05
R7624:Olfr918 UTSW 9 38672623 missense probably benign 0.18
R7862:Olfr918 UTSW 9 38673328 missense probably benign 0.01
R7945:Olfr918 UTSW 9 38673328 missense probably benign 0.01
R8116:Olfr918 UTSW 9 38673168 missense possibly damaging 0.93
Predicted Primers PCR Primer
(F):5'- AATGTGAGAGCTGCAGGTGC -3'
(R):5'- TCTGAATGCTACATGTTGACCTC -3'

Sequencing Primer
(F):5'- GCTGAAGGCTTTTGATCTTCC -3'
(R):5'- CAATGGCCTATGATCGCTATGTAGC -3'
Posted On2014-10-02