Incidental Mutation 'R0178:Olfr691'
ID23765
Institutional Source Beutler Lab
Gene Symbol Olfr691
Ensembl Gene ENSMUSG00000043948
Gene Nameolfactory receptor 691
SynonymsGA_x6K02T2PBJ9-7966695-7965727, MOR31-6
MMRRC Submission 038446-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.129) question?
Stock #R0178 (G1)
Quality Score225
Status Validated (trace)
Chromosome7
Chromosomal Location105335509-105342270 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 105336922 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Cysteine at position 265 (R265C)
Ref Sequence ENSEMBL: ENSMUSP00000150297 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000057528] [ENSMUST00000211006] [ENSMUST00000213290] [ENSMUST00000216230]
Predicted Effect probably benign
Transcript: ENSMUST00000057528
AA Change: R265C

PolyPhen 2 Score 0.072 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000061078
Gene: ENSMUSG00000043948
AA Change: R265C

DomainStartEndE-ValueType
Pfam:7tm_4 33 312 1e-112 PFAM
Pfam:7TM_GPCR_Srsx 37 291 1.3e-10 PFAM
Pfam:7tm_1 43 294 3.7e-19 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000211006
Predicted Effect probably benign
Transcript: ENSMUST00000213290
AA Change: R265C

PolyPhen 2 Score 0.072 (Sensitivity: 0.94; Specificity: 0.84)
Predicted Effect probably benign
Transcript: ENSMUST00000216230
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 98.9%
  • 3x: 98.1%
  • 10x: 95.5%
  • 20x: 88.8%
Validation Efficiency 95% (69/73)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 53 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700125H20Rik A G 11: 85,178,438 H94R probably benign Het
4922502D21Rik T C 6: 129,326,823 R60G probably benign Het
4930596D02Rik T G 14: 35,811,478 N111T probably benign Het
9930021J03Rik A G 19: 29,754,788 S342P probably damaging Het
Abca1 T C 4: 53,081,953 D769G possibly damaging Het
Adcy6 G T 15: 98,604,215 Q173K probably benign Het
Amotl1 G A 9: 14,548,773 A890V probably benign Het
Arfgap2 C T 2: 91,267,361 A141V probably benign Het
Asb2 G A 12: 103,325,552 P324L probably damaging Het
Cacna1g G A 11: 94,463,483 T202I probably damaging Het
Capn5 A G 7: 98,132,891 L214P probably damaging Het
Cdh20 A T 1: 104,975,051 D489V possibly damaging Het
Cers5 C A 15: 99,747,024 probably benign Het
Chrnb3 T A 8: 27,393,364 V111D probably damaging Het
Colec12 C T 18: 9,858,921 P568L unknown Het
Cyp2r1 T C 7: 114,550,408 E248G probably damaging Het
Dnmt3b A G 2: 153,675,018 T536A probably benign Het
Eef2 G A 10: 81,180,292 V496M possibly damaging Het
Fam118a T C 15: 85,045,880 probably benign Het
Fer1l6 T A 15: 58,637,914 probably null Het
Fhad1 A C 4: 141,955,340 F497V probably benign Het
Gbe1 G A 16: 70,478,386 G358D probably damaging Het
Gdf10 A G 14: 33,924,101 D69G probably damaging Het
Ggt6 A G 11: 72,436,818 H150R possibly damaging Het
Gm1966 A T 7: 106,601,821 Y739N probably damaging Het
Gm45713 A T 7: 45,134,458 L110Q probably damaging Het
Gm9847 T C 12: 14,494,648 noncoding transcript Het
Grwd1 T C 7: 45,830,630 E51G probably damaging Het
H13 A G 2: 152,681,067 Y100C probably damaging Het
Kcne1 A C 16: 92,348,809 M49R probably damaging Het
Kcnma1 C T 14: 23,526,767 R236H probably damaging Het
Knl1 T A 2: 119,058,405 probably benign Het
Krt40 T C 11: 99,541,739 I150M probably damaging Het
Ldb2 A T 5: 44,473,499 V300E probably damaging Het
Lrp1b A T 2: 40,725,907 C3606S probably damaging Het
Lrrc42 A G 4: 107,247,720 I16T probably damaging Het
Lrrc6 A C 15: 66,454,101 D208E probably benign Het
Mtus1 G T 8: 41,002,361 L87I possibly damaging Het
Myot T C 18: 44,336,986 F10S probably damaging Het
Nrg3 A T 14: 38,376,456 H480Q probably damaging Het
Olfr205 A T 16: 59,329,420 F30I probably damaging Het
Prl2c5 A T 13: 13,191,805 D220V probably damaging Het
Rbm17 G A 2: 11,587,779 S295L probably benign Het
Serpina6 A G 12: 103,646,913 I376T probably damaging Het
Sh2d2a A T 3: 87,849,423 T192S probably benign Het
Slc27a1 T C 8: 71,584,462 Y417H possibly damaging Het
Slc6a1 T G 6: 114,304,852 I32S possibly damaging Het
Sntb1 T C 15: 55,906,144 T150A probably damaging Het
Tanc1 T A 2: 59,835,447 C1183* probably null Het
Tmprss7 C A 16: 45,690,843 W57C probably damaging Het
Ubac1 A T 2: 26,021,428 V36E possibly damaging Het
Zfc3h1 T C 10: 115,406,725 probably benign Het
Zfp644 C T 5: 106,636,905 C592Y probably damaging Het
Other mutations in Olfr691
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02212:Olfr691 APN 7 105337143 missense probably damaging 1.00
R0344:Olfr691 UTSW 7 105337607 missense probably benign
R0931:Olfr691 UTSW 7 105337529 nonsense probably null
R1434:Olfr691 UTSW 7 105337261 missense probably benign
R1482:Olfr691 UTSW 7 105337256 missense probably damaging 0.97
R2189:Olfr691 UTSW 7 105337602 missense probably benign
R3836:Olfr691 UTSW 7 105337210 missense probably benign 0.05
R5353:Olfr691 UTSW 7 105337117 missense probably damaging 1.00
R6649:Olfr691 UTSW 7 105337707 missense probably benign 0.00
R6715:Olfr691 UTSW 7 105337332 missense probably damaging 1.00
R7462:Olfr691 UTSW 7 105337500 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GGACCAGTCATCCCAAAGGTGAAG -3'
(R):5'- CCCCATTCCTACTGTGAGCACATTG -3'

Sequencing Primer
(F):5'- GAACAACACAGAGTCTTGATGTCC -3'
(R):5'- CCGCTTAGCTTGTGCAGATATAAC -3'
Posted On2013-04-16