Incidental Mutation 'R2173:L3mbtl4'
ID237657
Institutional Source Beutler Lab
Gene Symbol L3mbtl4
Ensembl Gene ENSMUSG00000041565
Gene NameL3MBTL4 histone methyl-lysine binding protein
Synonyms
MMRRC Submission 040175-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R2173 (G1)
Quality Score225
Status Validated
Chromosome17
Chromosomal Location68273797-68777961 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 68587193 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Leucine at position 398 (H398L)
Ref Sequence ENSEMBL: ENSMUSP00000121045 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000093007] [ENSMUST00000124543] [ENSMUST00000139383]
Predicted Effect probably damaging
Transcript: ENSMUST00000093007
AA Change: H398L

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000094892
Gene: ENSMUSG00000041565
AA Change: H398L

DomainStartEndE-ValueType
MBT 52 152 2.24e-46 SMART
MBT 160 260 6.29e-41 SMART
MBT 269 364 2.8e-47 SMART
Pfam:zf-C2HC 378 407 8.1e-16 PFAM
SAM 540 607 5.17e-11 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000124543
AA Change: H398L

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000121045
Gene: ENSMUSG00000041565
AA Change: H398L

DomainStartEndE-ValueType
MBT 52 152 2.24e-46 SMART
MBT 160 260 6.29e-41 SMART
MBT 269 364 2.8e-47 SMART
Pfam:zf-C2HC 376 407 3.3e-15 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000139383
SMART Domains Protein: ENSMUSP00000117626
Gene: ENSMUSG00000041565

DomainStartEndE-ValueType
MBT 52 152 2.24e-46 SMART
MBT 160 260 6.29e-41 SMART
Meta Mutation Damage Score 0.9414 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.6%
Validation Efficiency 97% (66/68)
Allele List at MGI
Other mutations in this stock
Total: 64 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A930017K11Rik A C 17: 25,948,487 H25Q probably damaging Het
Alpk1 T A 3: 127,683,590 H273L probably damaging Het
Alpk3 A G 7: 81,076,900 Y111C probably damaging Het
Anapc2 T G 2: 25,273,276 V175G probably benign Het
Arhgap30 T C 1: 171,407,767 S570P probably damaging Het
AU040320 T C 4: 126,792,276 L215P probably benign Het
Ccdc59 A T 10: 105,841,527 K9M possibly damaging Het
Ccdc65 A G 15: 98,721,033 N298D probably benign Het
Cfap70 T A 14: 20,408,562 N727Y probably benign Het
Clcn7 A G 17: 25,145,609 H63R probably benign Het
Corin A T 5: 72,504,079 C24S probably benign Het
Cyp1a2 A G 9: 57,677,515 W419R probably damaging Het
Dlgap4 C A 2: 156,762,812 A256D probably damaging Het
Eif4enif1 A G 11: 3,242,367 probably null Het
Eri2 A G 7: 119,786,543 V245A possibly damaging Het
Erich6b T C 14: 75,658,892 F73L probably benign Het
Fam110a A G 2: 151,970,509 C114R probably damaging Het
Fam149a T C 8: 45,353,954 D288G probably damaging Het
Fam171a1 T A 2: 3,225,619 Y596* probably null Het
Fsd1 A G 17: 55,991,223 T183A possibly damaging Het
Fut10 T A 8: 31,236,131 Y305N probably damaging Het
Ganab A T 19: 8,902,260 probably benign Het
Gm9922 G T 14: 101,729,576 probably benign Het
Gp9 A G 6: 87,779,053 T17A probably benign Het
Gxylt2 T C 6: 100,798,154 Y345H probably damaging Het
Herc2 A G 7: 56,185,951 H3269R probably benign Het
Hpx A T 7: 105,592,083 S374T probably benign Het
Hspa5 T C 2: 34,774,662 V376A probably damaging Het
Hyi T C 4: 118,362,184 probably benign Het
Impdh2 G A 9: 108,565,394 probably null Het
Kremen2 A C 17: 23,742,796 W246G probably damaging Het
Krt83 A G 15: 101,487,937 V259A probably damaging Het
Lama5 C A 2: 180,196,242 V894L probably benign Het
Maml2 A G 9: 13,621,616 probably benign Het
Nup153 A T 13: 46,701,600 probably benign Het
Olfr1387 G T 11: 49,460,140 V154L probably benign Het
Olfr177 A G 16: 58,872,619 F177S probably damaging Het
Olfr824 G A 10: 130,126,503 P185S probably benign Het
Olfr918 T C 9: 38,672,944 I180V probably benign Het
Olfr981 T G 9: 40,023,254 I287S probably damaging Het
Otof C T 5: 30,386,374 R582H probably damaging Het
Otud4 T C 8: 79,668,464 S543P probably damaging Het
Pde6a A G 18: 61,254,382 D448G probably damaging Het
Phgdh A G 3: 98,315,111 V388A probably benign Het
Plin3 G T 17: 56,279,891 D385E possibly damaging Het
Polg G T 7: 79,455,593 D734E probably damaging Het
Pomt1 T C 2: 32,250,900 Y515H probably damaging Het
Pwwp2a G A 11: 43,682,486 A132T probably benign Het
Rbm6 A T 9: 107,852,191 F419L possibly damaging Het
Rfx5 A G 3: 94,956,716 probably null Het
Rnf135 G A 11: 80,189,240 S119N probably benign Het
Scfd1 T A 12: 51,387,079 D51E probably benign Het
Smox A T 2: 131,512,024 E5D possibly damaging Het
Srpk2 T C 5: 23,518,615 probably null Het
Syne2 T A 12: 76,100,989 probably benign Het
Tcf20 A G 15: 82,854,692 S853P possibly damaging Het
Tmem131l A G 3: 83,926,145 F804L probably damaging Het
Ttll8 A G 15: 88,914,597 L645P probably damaging Het
Ubr3 T A 2: 69,897,399 H35Q probably benign Het
Uck1 GCCAACACC GCC 2: 32,256,076 probably benign Het
Vmn2r70 A T 7: 85,565,082 H287Q probably benign Het
Vps26a A T 10: 62,468,392 I150N probably damaging Het
Zfp605 G A 5: 110,127,457 R147H probably benign Het
Zfyve16 A G 13: 92,495,088 M1333T probably damaging Het
Other mutations in L3mbtl4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01626:L3mbtl4 APN 17 68630202 missense probably damaging 1.00
IGL02274:L3mbtl4 APN 17 68764584 missense probably benign 0.01
IGL02304:L3mbtl4 APN 17 68587185 nonsense probably null
IGL02473:L3mbtl4 APN 17 68559777 missense possibly damaging 0.93
IGL02543:L3mbtl4 APN 17 68461612 splice site probably benign
IGL02706:L3mbtl4 APN 17 68486919 missense probably damaging 1.00
IGL02729:L3mbtl4 APN 17 68484743 missense probably benign 0.23
IGL02817:L3mbtl4 APN 17 68630254 missense probably benign 0.30
IGL03237:L3mbtl4 APN 17 68777861 missense probably damaging 1.00
IGL03371:L3mbtl4 APN 17 68461568 missense probably damaging 1.00
R0092:L3mbtl4 UTSW 17 68425703 missense probably benign 0.01
R0389:L3mbtl4 UTSW 17 68455780 missense probably damaging 1.00
R0504:L3mbtl4 UTSW 17 68777912 missense probably benign 0.07
R0598:L3mbtl4 UTSW 17 68459773 missense probably benign 0.04
R0650:L3mbtl4 UTSW 17 68774291 missense probably damaging 1.00
R0652:L3mbtl4 UTSW 17 68774291 missense probably damaging 1.00
R0842:L3mbtl4 UTSW 17 68486962 missense probably benign 0.19
R1900:L3mbtl4 UTSW 17 68459805 missense probably damaging 0.99
R2065:L3mbtl4 UTSW 17 68425692 missense probably benign 0.04
R2987:L3mbtl4 UTSW 17 68359518 missense possibly damaging 0.89
R3119:L3mbtl4 UTSW 17 68425674 missense probably benign 0.02
R3153:L3mbtl4 UTSW 17 68457248 nonsense probably null
R4044:L3mbtl4 UTSW 17 68777914 missense possibly damaging 0.63
R4579:L3mbtl4 UTSW 17 68764640 missense probably benign
R4717:L3mbtl4 UTSW 17 68455713 missense probably null 0.67
R4798:L3mbtl4 UTSW 17 68359480 start codon destroyed probably null 0.03
R4831:L3mbtl4 UTSW 17 68461563 missense probably damaging 0.98
R4852:L3mbtl4 UTSW 17 68559753 missense probably damaging 1.00
R5226:L3mbtl4 UTSW 17 68764722 critical splice donor site probably null
R5402:L3mbtl4 UTSW 17 68455774 missense probably damaging 1.00
R5604:L3mbtl4 UTSW 17 68777922 missense probably benign 0.01
R6377:L3mbtl4 UTSW 17 68777923 missense probably benign 0.04
R6708:L3mbtl4 UTSW 17 68630258 missense probably benign 0.19
R6853:L3mbtl4 UTSW 17 68777920 missense probably damaging 0.97
R6905:L3mbtl4 UTSW 17 68777888 missense probably benign 0.05
R7018:L3mbtl4 UTSW 17 68486943 missense probably damaging 1.00
R7045:L3mbtl4 UTSW 17 68461566 missense probably benign 0.00
R7047:L3mbtl4 UTSW 17 68461566 missense probably benign 0.00
R7049:L3mbtl4 UTSW 17 68461566 missense probably benign 0.00
R7419:L3mbtl4 UTSW 17 68641542 missense probably benign 0.28
R8271:L3mbtl4 UTSW 17 68486943 missense probably damaging 1.00
X0063:L3mbtl4 UTSW 17 68630253 missense probably benign 0.37
Z1176:L3mbtl4 UTSW 17 68425687 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGTCCTCGGTCATTTCATTGAC -3'
(R):5'- GGACTTAGAAATGCCTCCGC -3'

Sequencing Primer
(F):5'- CGTTTCAGTTAACGTCATTTACATAG -3'
(R):5'- TGCCTCCGCATCCCAAG -3'
Posted On2014-10-02