Incidental Mutation 'R2174:Capn2'
ID237665
Institutional Source Beutler Lab
Gene Symbol Capn2
Ensembl Gene ENSMUSG00000026509
Gene Namecalpain 2
SynonymsCapa-2, Capa2, m-calpain
MMRRC Submission 040176-MU
Accession Numbers

Genbank: NM_009794 ; MGI: 88264

Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R2174 (G1)
Quality Score225
Status Validated
Chromosome1
Chromosomal Location182467260-182517608 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 182479725 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Asparagine at position 516 (I516N)
Ref Sequence ENSEMBL: ENSMUSP00000068895 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000068505]
Predicted Effect probably benign
Transcript: ENSMUST00000068505
AA Change: I516N

PolyPhen 2 Score 0.222 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000068895
Gene: ENSMUSG00000026509
AA Change: I516N

DomainStartEndE-ValueType
CysPc 27 352 1.62e-186 SMART
calpain_III 355 510 3.47e-90 SMART
low complexity region 513 532 N/A INTRINSIC
EFh 576 604 5.86e0 SMART
EFh 606 634 3.21e0 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000192230
Predicted Effect noncoding transcript
Transcript: ENSMUST00000192483
Predicted Effect noncoding transcript
Transcript: ENSMUST00000192568
Predicted Effect noncoding transcript
Transcript: ENSMUST00000194940
Predicted Effect noncoding transcript
Transcript: ENSMUST00000194961
Meta Mutation Damage Score 0.1115 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.7%
Validation Efficiency 99% (73/74)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The calpains, calcium-activated neutral proteases, are nonlysosomal, intracellular cysteine proteases. The mammalian calpains include ubiquitous, stomach-specific, and muscle-specific proteins. The ubiquitous enzymes consist of heterodimers with distinct large, catalytic subunits associated with a common small, regulatory subunit. This gene encodes the large subunit of the ubiquitous enzyme, calpain 2. Multiple heterogeneous transcriptional start sites in the 5' UTR have been reported. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Mar 2009]
PHENOTYPE: Homozygous inactivation of this gene leads to complete prenatal lethality. Mice homozygous for one null allele display placental dysfunction, thin ventricular walls, and peripheral vessel failure. [provided by MGI curators]
Allele List at MGI

All alleles(1) : Targeted, knock-out(1)

Other mutations in this stock
Total: 72 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1600014C10Rik T C 7: 38,194,828 I95T possibly damaging Het
4930452B06Rik T C 14: 8,558,109 I159V probably benign Het
Adarb1 A G 10: 77,295,798 I619T probably benign Het
Aldh2 T C 5: 121,572,668 probably benign Het
Antxrl T A 14: 34,060,400 L180Q probably damaging Het
Asnsd1 A T 1: 53,347,601 I289N probably benign Het
Asxl3 T G 18: 22,453,644 S164A possibly damaging Het
Cacnb2 C T 2: 14,958,767 T108I probably benign Het
Casc1 T C 6: 145,175,170 H641R probably damaging Het
Ccdc59 A T 10: 105,841,527 K9M possibly damaging Het
Cenpo T C 12: 4,217,318 K73R probably benign Het
Clasp1 A G 1: 118,560,095 H823R probably damaging Het
Col6a4 T C 9: 106,060,132 D1395G probably damaging Het
Ddx60 A G 8: 61,956,141 I404V probably damaging Het
Ddx60 G T 8: 62,017,200 M1407I probably benign Het
Dennd3 A T 15: 73,555,305 R844W probably damaging Het
Depdc1b A T 13: 108,362,253 K157* probably null Het
Dnajc1 T C 2: 18,307,951 D196G probably damaging Het
Fanca A G 8: 123,271,270 W1226R probably benign Het
Fbxl13 A G 5: 21,582,048 V297A possibly damaging Het
Fnta A T 8: 26,013,470 F96I possibly damaging Het
Fzd3 T C 14: 65,212,231 probably benign Het
Gckr T C 5: 31,327,009 V597A possibly damaging Het
Gm43302 T C 5: 105,274,350 K496R probably benign Het
Gm5283 A G 3: 17,230,841 noncoding transcript Het
Gm5724 A T 6: 141,727,593 Y406* probably null Het
Gm6741 A G 17: 91,236,904 I32V probably benign Het
Gnptab T A 10: 88,434,044 F870I probably damaging Het
Gpx8 G A 13: 113,045,606 P98S probably benign Het
Grm2 T C 9: 106,647,795 I574V probably benign Het
Gtf3c5 T C 2: 28,567,775 D468G probably benign Het
Hectd3 A T 4: 116,999,701 M482L probably benign Het
Ier5 G T 1: 155,098,853 P193H possibly damaging Het
Inpp4a A G 1: 37,396,130 N827S probably damaging Het
Kif13a A G 13: 46,769,176 L387P probably damaging Het
Map3k1 G C 13: 111,752,482 H1314D possibly damaging Het
Mbl2 G A 19: 30,234,012 C11Y possibly damaging Het
Msr1 A G 8: 39,631,340 L58P probably damaging Het
Mtmr10 T A 7: 64,336,764 F530Y possibly damaging Het
Myo7b A G 18: 31,983,557 L999P probably damaging Het
Myoz3 T C 18: 60,590,224 E8G probably benign Het
Naip6 C A 13: 100,298,987 M1009I probably benign Het
Nav2 T A 7: 49,452,663 M342K probably damaging Het
Ndufaf6 T C 4: 11,070,228 H131R probably benign Het
Nlrp4a T C 7: 26,449,424 L152P probably damaging Het
Olfr1413 A G 1: 92,573,657 N162S probably benign Het
Pan3 T C 5: 147,450,653 I144T possibly damaging Het
Prkdc A T 16: 15,734,922 Q2074L probably benign Het
Pthlh G A 6: 147,257,012 T150I probably benign Het
Ptprq A T 10: 107,705,553 Y371N probably damaging Het
Rfwd3 A G 8: 111,283,343 S377P probably damaging Het
Rpl31-ps17 C T 12: 54,701,612 noncoding transcript Het
Sap130 T C 18: 31,677,479 probably null Het
Sap25 T G 5: 137,642,629 M229R possibly damaging Het
Scaper A T 9: 55,859,037 V479E probably null Het
Scn3a T A 2: 65,507,206 D649V probably damaging Het
Smc1b A G 15: 85,121,851 probably benign Het
Sowahb T C 5: 93,044,425 E145G possibly damaging Het
Stxbp5 T A 10: 9,835,846 I277F possibly damaging Het
Tanc1 T C 2: 59,843,833 S1754P possibly damaging Het
Tanc2 A G 11: 105,910,309 D1117G probably benign Het
Tbc1d31 A G 15: 57,951,741 M605V possibly damaging Het
Tekt3 A T 11: 63,094,688 D440V possibly damaging Het
Tmem67 C T 4: 12,063,730 W477* probably null Het
Tra2a T C 6: 49,250,927 probably benign Het
Trappc12 A G 12: 28,747,381 F51L possibly damaging Het
Trrap C A 5: 144,821,855 P2183Q probably benign Het
Ubn2 T A 6: 38,470,141 probably null Het
Unc5d A T 8: 28,694,540 V644E probably damaging Het
Xpo4 A G 14: 57,590,090 L883P probably damaging Het
Zbbx T G 3: 75,052,414 D616A possibly damaging Het
Zfp943 T A 17: 21,992,823 C297S probably damaging Het
Other mutations in Capn2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02049:Capn2 APN 1 182473954 splice site probably benign
IGL02589:Capn2 APN 1 182484348 missense probably damaging 1.00
IGL02679:Capn2 APN 1 182472584 missense probably benign
IGL03207:Capn2 APN 1 182489013 missense possibly damaging 0.92
E7848:Capn2 UTSW 1 182486594 missense possibly damaging 0.67
R0070:Capn2 UTSW 1 182473869 splice site probably benign
R0070:Capn2 UTSW 1 182473869 splice site probably benign
R0540:Capn2 UTSW 1 182492184 nonsense probably null
R0571:Capn2 UTSW 1 182470760 missense probably benign 0.01
R1620:Capn2 UTSW 1 182517137 missense probably damaging 1.00
R1818:Capn2 UTSW 1 182472597 missense probably benign 0.00
R1819:Capn2 UTSW 1 182472597 missense probably benign 0.00
R1822:Capn2 UTSW 1 182472960 missense possibly damaging 0.95
R1880:Capn2 UTSW 1 182489016 missense probably damaging 1.00
R2391:Capn2 UTSW 1 182478609 missense probably benign 0.01
R2860:Capn2 UTSW 1 182472920 splice site probably benign
R2861:Capn2 UTSW 1 182472920 splice site probably benign
R2878:Capn2 UTSW 1 182517233 missense probably benign 0.00
R3052:Capn2 UTSW 1 182487772 missense probably benign 0.06
R4463:Capn2 UTSW 1 182479764 intron probably benign
R4669:Capn2 UTSW 1 182470780 missense probably benign 0.00
R5077:Capn2 UTSW 1 182472573 missense possibly damaging 0.71
R5397:Capn2 UTSW 1 182470706 missense probably damaging 1.00
R5696:Capn2 UTSW 1 182478600 missense possibly damaging 0.79
R6777:Capn2 UTSW 1 182470177 critical splice donor site probably null
R6800:Capn2 UTSW 1 182481480 missense probably damaging 0.99
R7741:Capn2 UTSW 1 182479723 nonsense probably null
R7814:Capn2 UTSW 1 182492146 missense probably damaging 1.00
R7995:Capn2 UTSW 1 182478546 critical splice donor site probably null
Predicted Primers PCR Primer
(F):5'- TCGGGCTTTAATGAACAAGAGAC -3'
(R):5'- TTGCTCTATTCCACACGGG -3'

Sequencing Primer
(F):5'- CTTTAATGAACAAGAGACTGGCTG -3'
(R):5'- AAAAAGTATCTCTGCCCTGGCTACTG -3'
Posted On2014-10-02