Incidental Mutation 'R0178:Cyp2r1'
ID23767
Institutional Source Beutler Lab
Gene Symbol Cyp2r1
Ensembl Gene ENSMUSG00000030670
Gene Namecytochrome P450, family 2, subfamily r, polypeptide 1
Synonyms
MMRRC Submission 038446-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R0178 (G1)
Quality Score225
Status Validated (trace)
Chromosome7
Chromosomal Location114549682-114562972 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 114550408 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Glycine at position 248 (E248G)
Ref Sequence ENSEMBL: ENSMUSP00000147544 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000032908] [ENSMUST00000119712] [ENSMUST00000128587] [ENSMUST00000138712] [ENSMUST00000147428] [ENSMUST00000211506]
Predicted Effect probably damaging
Transcript: ENSMUST00000032908
AA Change: E457G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000032908
Gene: ENSMUSG00000030670
AA Change: E457G

DomainStartEndE-ValueType
transmembrane domain 9 31 N/A INTRINSIC
Pfam:p450 40 498 7e-122 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000119712
AA Change: E246G

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000112818
Gene: ENSMUSG00000030670
AA Change: E246G

DomainStartEndE-ValueType
transmembrane domain 5 27 N/A INTRINSIC
Pfam:p450 40 124 2.3e-15 PFAM
Pfam:p450 115 287 1.8e-60 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000128587
SMART Domains Protein: ENSMUSP00000121924
Gene: ENSMUSG00000030670

DomainStartEndE-ValueType
Pfam:p450 1 260 5.7e-47 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000133484
Predicted Effect probably benign
Transcript: ENSMUST00000138712
SMART Domains Protein: ENSMUSP00000123556
Gene: ENSMUSG00000030670

DomainStartEndE-ValueType
transmembrane domain 5 27 N/A INTRINSIC
SCOP:d1dt6a_ 40 76 5e-7 SMART
PDB:3CZH|B 51 76 3e-7 PDB
Predicted Effect probably benign
Transcript: ENSMUST00000147428
SMART Domains Protein: ENSMUSP00000119605
Gene: ENSMUSG00000030670

DomainStartEndE-ValueType
transmembrane domain 5 27 N/A INTRINSIC
SCOP:d1dt6a_ 40 76 5e-7 SMART
PDB:3CZH|B 51 76 3e-7 PDB
Predicted Effect probably damaging
Transcript: ENSMUST00000211506
AA Change: E248G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Meta Mutation Damage Score 0.9660 question?
Coding Region Coverage
  • 1x: 98.9%
  • 3x: 98.1%
  • 10x: 95.5%
  • 20x: 88.8%
Validation Efficiency 95% (69/73)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the cytochrome P450 superfamily of enzymes. The cytochrome P450 proteins are monooxygenases which catalyze many reactions involved in drug metabolism and synthesis of cholesterol, steroids and other lipids. This enzyme is a microsomal vitamin D hydroxylase that converts vitamin D into the active ligand for the vitamin D receptor. A mutation in this gene has been associated with selective 25-hydroxyvitamin D deficiency. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit more than a 50% reduction in serum 25-hydroxyvitamin D3 levels but remain healthy and show normal serum 1alpha,25-dihydroxyvitamin D3 levels. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 53 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700125H20Rik A G 11: 85,178,438 H94R probably benign Het
4922502D21Rik T C 6: 129,326,823 R60G probably benign Het
4930596D02Rik T G 14: 35,811,478 N111T probably benign Het
9930021J03Rik A G 19: 29,754,788 S342P probably damaging Het
Abca1 T C 4: 53,081,953 D769G possibly damaging Het
Adcy6 G T 15: 98,604,215 Q173K probably benign Het
Amotl1 G A 9: 14,548,773 A890V probably benign Het
Arfgap2 C T 2: 91,267,361 A141V probably benign Het
Asb2 G A 12: 103,325,552 P324L probably damaging Het
Cacna1g G A 11: 94,463,483 T202I probably damaging Het
Capn5 A G 7: 98,132,891 L214P probably damaging Het
Cdh20 A T 1: 104,975,051 D489V possibly damaging Het
Cers5 C A 15: 99,747,024 probably benign Het
Chrnb3 T A 8: 27,393,364 V111D probably damaging Het
Colec12 C T 18: 9,858,921 P568L unknown Het
Dnmt3b A G 2: 153,675,018 T536A probably benign Het
Eef2 G A 10: 81,180,292 V496M possibly damaging Het
Fam118a T C 15: 85,045,880 probably benign Het
Fer1l6 T A 15: 58,637,914 probably null Het
Fhad1 A C 4: 141,955,340 F497V probably benign Het
Gbe1 G A 16: 70,478,386 G358D probably damaging Het
Gdf10 A G 14: 33,924,101 D69G probably damaging Het
Ggt6 A G 11: 72,436,818 H150R possibly damaging Het
Gm1966 A T 7: 106,601,821 Y739N probably damaging Het
Gm45713 A T 7: 45,134,458 L110Q probably damaging Het
Gm9847 T C 12: 14,494,648 noncoding transcript Het
Grwd1 T C 7: 45,830,630 E51G probably damaging Het
H13 A G 2: 152,681,067 Y100C probably damaging Het
Kcne1 A C 16: 92,348,809 M49R probably damaging Het
Kcnma1 C T 14: 23,526,767 R236H probably damaging Het
Knl1 T A 2: 119,058,405 probably benign Het
Krt40 T C 11: 99,541,739 I150M probably damaging Het
Ldb2 A T 5: 44,473,499 V300E probably damaging Het
Lrp1b A T 2: 40,725,907 C3606S probably damaging Het
Lrrc42 A G 4: 107,247,720 I16T probably damaging Het
Lrrc6 A C 15: 66,454,101 D208E probably benign Het
Mtus1 G T 8: 41,002,361 L87I possibly damaging Het
Myot T C 18: 44,336,986 F10S probably damaging Het
Nrg3 A T 14: 38,376,456 H480Q probably damaging Het
Olfr205 A T 16: 59,329,420 F30I probably damaging Het
Olfr691 G A 7: 105,336,922 R265C probably benign Het
Prl2c5 A T 13: 13,191,805 D220V probably damaging Het
Rbm17 G A 2: 11,587,779 S295L probably benign Het
Serpina6 A G 12: 103,646,913 I376T probably damaging Het
Sh2d2a A T 3: 87,849,423 T192S probably benign Het
Slc27a1 T C 8: 71,584,462 Y417H possibly damaging Het
Slc6a1 T G 6: 114,304,852 I32S possibly damaging Het
Sntb1 T C 15: 55,906,144 T150A probably damaging Het
Tanc1 T A 2: 59,835,447 C1183* probably null Het
Tmprss7 C A 16: 45,690,843 W57C probably damaging Het
Ubac1 A T 2: 26,021,428 V36E possibly damaging Het
Zfc3h1 T C 10: 115,406,725 probably benign Het
Zfp644 C T 5: 106,636,905 C592Y probably damaging Het
Other mutations in Cyp2r1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00535:Cyp2r1 APN 7 114551826 missense probably benign 0.00
IGL01515:Cyp2r1 APN 7 114552712 splice site probably benign
R0518:Cyp2r1 UTSW 7 114552900 missense probably benign 0.01
R0686:Cyp2r1 UTSW 7 114552011 missense possibly damaging 0.52
R1772:Cyp2r1 UTSW 7 114553216 missense probably damaging 0.99
R2044:Cyp2r1 UTSW 7 114550405 missense probably damaging 0.98
R3785:Cyp2r1 UTSW 7 114554696 missense possibly damaging 0.69
R6248:Cyp2r1 UTSW 7 114562731 critical splice donor site probably null
R6995:Cyp2r1 UTSW 7 114553081 missense probably damaging 1.00
R7048:Cyp2r1 UTSW 7 114552736 missense probably damaging 1.00
R7063:Cyp2r1 UTSW 7 114552949 missense probably damaging 1.00
R7538:Cyp2r1 UTSW 7 114562767 missense probably damaging 1.00
R7549:Cyp2r1 UTSW 7 114554644 missense possibly damaging 0.58
R7680:Cyp2r1 UTSW 7 114552819 missense probably damaging 1.00
R7882:Cyp2r1 UTSW 7 114554589 critical splice donor site probably null
R8054:Cyp2r1 UTSW 7 114552084 critical splice acceptor site probably null
R8116:Cyp2r1 UTSW 7 114550355 missense probably benign
R8326:Cyp2r1 UTSW 7 114553170 missense probably damaging 1.00
Z1088:Cyp2r1 UTSW 7 114551974 missense probably damaging 1.00
Z1177:Cyp2r1 UTSW 7 114553339 nonsense probably null
Predicted Primers PCR Primer
(F):5'- GGCCCTTCTAAGTGTCTTCATAACACC -3'
(R):5'- TTGAAATGGGCTTCCCTTGGATCAAT -3'

Sequencing Primer
(F):5'- AATGTGGCTTTGGCCCAAAC -3'
(R):5'- GGGCTTCCCTTGGATCAATAAAAAC -3'
Posted On2013-04-16