Incidental Mutation 'R2174:Hectd3'
ID 237677
Institutional Source Beutler Lab
Gene Symbol Hectd3
Ensembl Gene ENSMUSG00000046861
Gene Name HECT domain E3 ubiquitin protein ligase 3
Synonyms 1700064K09Rik
MMRRC Submission 040176-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R2174 (G1)
Quality Score 225
Status Validated
Chromosome 4
Chromosomal Location 116995317-117005277 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to T at 116999701 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Methionine to Leucine at position 482 (M482L)
Ref Sequence ENSEMBL: ENSMUSP00000051922 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000050067]
AlphaFold Q3U487
Predicted Effect probably benign
Transcript: ENSMUST00000050067
AA Change: M482L

PolyPhen 2 Score 0.041 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000051922
Gene: ENSMUSG00000046861
AA Change: M482L

DomainStartEndE-ValueType
low complexity region 26 41 N/A INTRINSIC
low complexity region 68 81 N/A INTRINSIC
APC10 237 391 6.75e-23 SMART
HECTc 514 857 1.27e-30 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000133234
Predicted Effect noncoding transcript
Transcript: ENSMUST00000138729
Predicted Effect noncoding transcript
Transcript: ENSMUST00000155267
Meta Mutation Damage Score 0.0679 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.7%
Validation Efficiency 99% (73/74)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene transfers ubiquitin from an E2 ubiquitin-conjugating enzyme to targeted substrates, leading to the degradation of those substrates. The encoded protein has been shown to transfer ubiquitin to TRIOBP to facilitate cell cycle progression, and to STX8. [provided by RefSeq, Dec 2012]
Allele List at MGI
Other mutations in this stock
Total: 72 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1600014C10Rik T C 7: 38,194,828 I95T possibly damaging Het
4930452B06Rik T C 14: 8,558,109 I159V probably benign Het
Adarb1 A G 10: 77,295,798 I619T probably benign Het
Aldh2 T C 5: 121,572,668 probably benign Het
Antxrl T A 14: 34,060,400 L180Q probably damaging Het
Asnsd1 A T 1: 53,347,601 I289N probably benign Het
Asxl3 T G 18: 22,453,644 S164A possibly damaging Het
Cacnb2 C T 2: 14,958,767 T108I probably benign Het
Capn2 A T 1: 182,479,725 I516N probably benign Het
Casc1 T C 6: 145,175,170 H641R probably damaging Het
Ccdc59 A T 10: 105,841,527 K9M possibly damaging Het
Cenpo T C 12: 4,217,318 K73R probably benign Het
Clasp1 A G 1: 118,560,095 H823R probably damaging Het
Col6a4 T C 9: 106,060,132 D1395G probably damaging Het
Ddx60 A G 8: 61,956,141 I404V probably damaging Het
Ddx60 G T 8: 62,017,200 M1407I probably benign Het
Dennd3 A T 15: 73,555,305 R844W probably damaging Het
Depdc1b A T 13: 108,362,253 K157* probably null Het
Dnajc1 T C 2: 18,307,951 D196G probably damaging Het
Fanca A G 8: 123,271,270 W1226R probably benign Het
Fbxl13 A G 5: 21,582,048 V297A possibly damaging Het
Fnta A T 8: 26,013,470 F96I possibly damaging Het
Fzd3 T C 14: 65,212,231 probably benign Het
Gckr T C 5: 31,327,009 V597A possibly damaging Het
Gm43302 T C 5: 105,274,350 K496R probably benign Het
Gm5283 A G 3: 17,230,841 noncoding transcript Het
Gm5724 A T 6: 141,727,593 Y406* probably null Het
Gm6741 A G 17: 91,236,904 I32V probably benign Het
Gnptab T A 10: 88,434,044 F870I probably damaging Het
Gpx8 G A 13: 113,045,606 P98S probably benign Het
Grm2 T C 9: 106,647,795 I574V probably benign Het
Gtf3c5 T C 2: 28,567,775 D468G probably benign Het
Ier5 G T 1: 155,098,853 P193H possibly damaging Het
Inpp4a A G 1: 37,396,130 N827S probably damaging Het
Kif13a A G 13: 46,769,176 L387P probably damaging Het
Map3k1 G C 13: 111,752,482 H1314D possibly damaging Het
Mbl2 G A 19: 30,234,012 C11Y possibly damaging Het
Msr1 A G 8: 39,631,340 L58P probably damaging Het
Mtmr10 T A 7: 64,336,764 F530Y possibly damaging Het
Myo7b A G 18: 31,983,557 L999P probably damaging Het
Myoz3 T C 18: 60,590,224 E8G probably benign Het
Naip6 C A 13: 100,298,987 M1009I probably benign Het
Nav2 T A 7: 49,452,663 M342K probably damaging Het
Ndufaf6 T C 4: 11,070,228 H131R probably benign Het
Nlrp4a T C 7: 26,449,424 L152P probably damaging Het
Olfr1413 A G 1: 92,573,657 N162S probably benign Het
Pan3 T C 5: 147,450,653 I144T possibly damaging Het
Prkdc A T 16: 15,734,922 Q2074L probably benign Het
Pthlh G A 6: 147,257,012 T150I probably benign Het
Ptprq A T 10: 107,705,553 Y371N probably damaging Het
Rfwd3 A G 8: 111,283,343 S377P probably damaging Het
Rpl31-ps17 C T 12: 54,701,612 noncoding transcript Het
Sap130 T C 18: 31,677,479 probably null Het
Sap25 T G 5: 137,642,629 M229R possibly damaging Het
Scaper A T 9: 55,859,037 V479E probably null Het
Scn3a T A 2: 65,507,206 D649V probably damaging Het
Smc1b A G 15: 85,121,851 probably benign Het
Sowahb T C 5: 93,044,425 E145G possibly damaging Het
Stxbp5 T A 10: 9,835,846 I277F possibly damaging Het
Tanc1 T C 2: 59,843,833 S1754P possibly damaging Het
Tanc2 A G 11: 105,910,309 D1117G probably benign Het
Tbc1d31 A G 15: 57,951,741 M605V possibly damaging Het
Tekt3 A T 11: 63,094,688 D440V possibly damaging Het
Tmem67 C T 4: 12,063,730 W477* probably null Het
Tra2a T C 6: 49,250,927 probably benign Het
Trappc12 A G 12: 28,747,381 F51L possibly damaging Het
Trrap C A 5: 144,821,855 P2183Q probably benign Het
Ubn2 T A 6: 38,470,141 probably null Het
Unc5d A T 8: 28,694,540 V644E probably damaging Het
Xpo4 A G 14: 57,590,090 L883P probably damaging Het
Zbbx T G 3: 75,052,414 D616A possibly damaging Het
Zfp943 T A 17: 21,992,823 C297S probably damaging Het
Other mutations in Hectd3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00227:Hectd3 APN 4 117000588 splice site probably benign
IGL00227:Hectd3 APN 4 117000587 splice site probably benign
IGL00227:Hectd3 APN 4 117000589 splice site probably benign
IGL00987:Hectd3 APN 4 116999643 missense probably damaging 0.98
IGL01402:Hectd3 APN 4 116996065 missense probably damaging 0.96
IGL01660:Hectd3 APN 4 116996372 missense possibly damaging 0.91
IGL02397:Hectd3 APN 4 117003136 missense possibly damaging 0.94
IGL03029:Hectd3 APN 4 116996965 nonsense probably null
chopstix2 UTSW 4 116996396 missense probably benign 0.08
R0147:Hectd3 UTSW 4 116997040 unclassified probably benign
R0240:Hectd3 UTSW 4 117002613 missense probably damaging 0.97
R0240:Hectd3 UTSW 4 117002613 missense probably damaging 0.97
R0611:Hectd3 UTSW 4 116996044 missense possibly damaging 0.67
R1367:Hectd3 UTSW 4 116997170 missense probably null 0.48
R1401:Hectd3 UTSW 4 117002269 missense possibly damaging 0.52
R1444:Hectd3 UTSW 4 116996396 missense probably benign 0.08
R1466:Hectd3 UTSW 4 116996566 missense probably damaging 0.98
R1466:Hectd3 UTSW 4 116996566 missense probably damaging 0.98
R1517:Hectd3 UTSW 4 117002994 missense probably damaging 0.96
R1584:Hectd3 UTSW 4 116996566 missense probably damaging 0.98
R1593:Hectd3 UTSW 4 116997020 missense possibly damaging 0.86
R1628:Hectd3 UTSW 4 116997392 missense probably damaging 1.00
R1669:Hectd3 UTSW 4 116999643 missense probably damaging 0.98
R1731:Hectd3 UTSW 4 116996455 critical splice donor site probably null
R1918:Hectd3 UTSW 4 117000343 missense possibly damaging 0.68
R2029:Hectd3 UTSW 4 117000685 missense probably damaging 0.99
R2184:Hectd3 UTSW 4 117000903 missense possibly damaging 0.93
R2226:Hectd3 UTSW 4 116995689 missense possibly damaging 0.67
R3721:Hectd3 UTSW 4 116999745 missense probably benign 0.08
R3895:Hectd3 UTSW 4 116996089 missense probably damaging 1.00
R3937:Hectd3 UTSW 4 116998530 missense probably benign 0.28
R4291:Hectd3 UTSW 4 116995692 missense probably damaging 1.00
R4729:Hectd3 UTSW 4 116997218 missense probably damaging 0.98
R4837:Hectd3 UTSW 4 117002597 missense probably null 0.32
R5059:Hectd3 UTSW 4 116997164 missense possibly damaging 0.93
R5090:Hectd3 UTSW 4 117000238 splice site probably benign
R5910:Hectd3 UTSW 4 117002134 missense probably benign 0.09
R5932:Hectd3 UTSW 4 117002273 missense possibly damaging 0.79
R6182:Hectd3 UTSW 4 117000279 missense probably damaging 1.00
R6292:Hectd3 UTSW 4 116998808 missense probably damaging 1.00
R6405:Hectd3 UTSW 4 117000624 missense probably benign 0.04
R6478:Hectd3 UTSW 4 116999586 missense probably damaging 1.00
R7444:Hectd3 UTSW 4 116996927 missense possibly damaging 0.48
R7471:Hectd3 UTSW 4 116996588 missense probably benign 0.01
R8053:Hectd3 UTSW 4 117000858 missense possibly damaging 0.65
R8671:Hectd3 UTSW 4 116996581 missense possibly damaging 0.67
R8840:Hectd3 UTSW 4 116998407 missense probably benign 0.14
Z1177:Hectd3 UTSW 4 116998760 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GGTCTAGGCGTAGAAAGTCC -3'
(R):5'- ACCTTCATAAACCTGGGGAGC -3'

Sequencing Primer
(F):5'- GCGTAGAAAGTCCCAGAGCC -3'
(R):5'- CTTCATAAACCTGGGGAGCAAGAG -3'
Posted On 2014-10-02