Incidental Mutation 'R2174:Fbxl13'
ID237679
Institutional Source Beutler Lab
Gene Symbol Fbxl13
Ensembl Gene ENSMUSG00000048520
Gene NameF-box and leucine-rich repeat protein 13
Synonyms4921539K22Rik
MMRRC Submission 040176-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R2174 (G1)
Quality Score225
Status Validated
Chromosome5
Chromosomal Location21483847-21645634 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 21582048 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 297 (V297A)
Ref Sequence ENSEMBL: ENSMUSP00000110889 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000051358] [ENSMUST00000115234]
Predicted Effect probably benign
Transcript: ENSMUST00000051358
AA Change: V297A

PolyPhen 2 Score 0.035 (Sensitivity: 0.94; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000052716
Gene: ENSMUSG00000048520
AA Change: V297A

DomainStartEndE-ValueType
low complexity region 160 173 N/A INTRINSIC
FBOX 243 283 3.73e-4 SMART
LRR_CC 328 353 6.62e-6 SMART
LRR 354 378 3.67e2 SMART
LRR 379 404 2.75e-3 SMART
LRR 407 425 4.51e2 SMART
LRR 426 451 2.63e0 SMART
LRR 476 501 4.15e1 SMART
LRR 502 526 1.82e1 SMART
LRR 529 554 1.76e-1 SMART
LRR_CC 555 580 4.61e-5 SMART
LRR 604 629 8.81e-2 SMART
LRR 630 655 2.37e1 SMART
LRR 656 681 3.21e-4 SMART
LRR 682 707 6.57e-1 SMART
LRR 708 733 9.47e1 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000115234
AA Change: V297A

PolyPhen 2 Score 0.740 (Sensitivity: 0.85; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000110889
Gene: ENSMUSG00000048520
AA Change: V297A

DomainStartEndE-ValueType
low complexity region 160 173 N/A INTRINSIC
FBOX 243 283 3.73e-4 SMART
LRR_CC 328 353 6.62e-6 SMART
LRR 354 378 3.67e2 SMART
LRR 379 404 2.75e-3 SMART
LRR 407 432 6.88e-4 SMART
Blast:LRR 433 458 7e-8 BLAST
LRR 459 484 2.63e0 SMART
LRR 509 534 4.15e1 SMART
LRR 535 559 1.82e1 SMART
LRR 562 587 1.76e-1 SMART
LRR_CC 588 613 4.61e-5 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000137788
Predicted Effect noncoding transcript
Transcript: ENSMUST00000153598
Meta Mutation Damage Score 0.1639 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.7%
Validation Efficiency 99% (73/74)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Members of the F-box protein family, such as FBXL13, are characterized by an approximately 40-amino acid F-box motif. SCF complexes, formed by SKP1 (MIM 601434), cullin (see CUL1; MIM 603134), and F-box proteins, act as protein-ubiquitin ligases. F-box proteins interact with SKP1 through the F box, and they interact with ubiquitination targets through other protein interaction domains (Jin et al., 2004 [PubMed 15520277]).[supplied by OMIM, Mar 2008]
Allele List at MGI
Other mutations in this stock
Total: 72 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1600014C10Rik T C 7: 38,194,828 I95T possibly damaging Het
4930452B06Rik T C 14: 8,558,109 I159V probably benign Het
Adarb1 A G 10: 77,295,798 I619T probably benign Het
Aldh2 T C 5: 121,572,668 probably benign Het
Antxrl T A 14: 34,060,400 L180Q probably damaging Het
Asnsd1 A T 1: 53,347,601 I289N probably benign Het
Asxl3 T G 18: 22,453,644 S164A possibly damaging Het
Cacnb2 C T 2: 14,958,767 T108I probably benign Het
Capn2 A T 1: 182,479,725 I516N probably benign Het
Casc1 T C 6: 145,175,170 H641R probably damaging Het
Ccdc59 A T 10: 105,841,527 K9M possibly damaging Het
Cenpo T C 12: 4,217,318 K73R probably benign Het
Clasp1 A G 1: 118,560,095 H823R probably damaging Het
Col6a4 T C 9: 106,060,132 D1395G probably damaging Het
Ddx60 A G 8: 61,956,141 I404V probably damaging Het
Ddx60 G T 8: 62,017,200 M1407I probably benign Het
Dennd3 A T 15: 73,555,305 R844W probably damaging Het
Depdc1b A T 13: 108,362,253 K157* probably null Het
Dnajc1 T C 2: 18,307,951 D196G probably damaging Het
Fanca A G 8: 123,271,270 W1226R probably benign Het
Fnta A T 8: 26,013,470 F96I possibly damaging Het
Fzd3 T C 14: 65,212,231 probably benign Het
Gckr T C 5: 31,327,009 V597A possibly damaging Het
Gm43302 T C 5: 105,274,350 K496R probably benign Het
Gm5283 A G 3: 17,230,841 noncoding transcript Het
Gm5724 A T 6: 141,727,593 Y406* probably null Het
Gm6741 A G 17: 91,236,904 I32V probably benign Het
Gnptab T A 10: 88,434,044 F870I probably damaging Het
Gpx8 G A 13: 113,045,606 P98S probably benign Het
Grm2 T C 9: 106,647,795 I574V probably benign Het
Gtf3c5 T C 2: 28,567,775 D468G probably benign Het
Hectd3 A T 4: 116,999,701 M482L probably benign Het
Ier5 G T 1: 155,098,853 P193H possibly damaging Het
Inpp4a A G 1: 37,396,130 N827S probably damaging Het
Kif13a A G 13: 46,769,176 L387P probably damaging Het
Map3k1 G C 13: 111,752,482 H1314D possibly damaging Het
Mbl2 G A 19: 30,234,012 C11Y possibly damaging Het
Msr1 A G 8: 39,631,340 L58P probably damaging Het
Mtmr10 T A 7: 64,336,764 F530Y possibly damaging Het
Myo7b A G 18: 31,983,557 L999P probably damaging Het
Myoz3 T C 18: 60,590,224 E8G probably benign Het
Naip6 C A 13: 100,298,987 M1009I probably benign Het
Nav2 T A 7: 49,452,663 M342K probably damaging Het
Ndufaf6 T C 4: 11,070,228 H131R probably benign Het
Nlrp4a T C 7: 26,449,424 L152P probably damaging Het
Olfr1413 A G 1: 92,573,657 N162S probably benign Het
Pan3 T C 5: 147,450,653 I144T possibly damaging Het
Prkdc A T 16: 15,734,922 Q2074L probably benign Het
Pthlh G A 6: 147,257,012 T150I probably benign Het
Ptprq A T 10: 107,705,553 Y371N probably damaging Het
Rfwd3 A G 8: 111,283,343 S377P probably damaging Het
Rpl31-ps17 C T 12: 54,701,612 noncoding transcript Het
Sap130 T C 18: 31,677,479 probably null Het
Sap25 T G 5: 137,642,629 M229R possibly damaging Het
Scaper A T 9: 55,859,037 V479E probably null Het
Scn3a T A 2: 65,507,206 D649V probably damaging Het
Smc1b A G 15: 85,121,851 probably benign Het
Sowahb T C 5: 93,044,425 E145G possibly damaging Het
Stxbp5 T A 10: 9,835,846 I277F possibly damaging Het
Tanc1 T C 2: 59,843,833 S1754P possibly damaging Het
Tanc2 A G 11: 105,910,309 D1117G probably benign Het
Tbc1d31 A G 15: 57,951,741 M605V possibly damaging Het
Tekt3 A T 11: 63,094,688 D440V possibly damaging Het
Tmem67 C T 4: 12,063,730 W477* probably null Het
Tra2a T C 6: 49,250,927 probably benign Het
Trappc12 A G 12: 28,747,381 F51L possibly damaging Het
Trrap C A 5: 144,821,855 P2183Q probably benign Het
Ubn2 T A 6: 38,470,141 probably null Het
Unc5d A T 8: 28,694,540 V644E probably damaging Het
Xpo4 A G 14: 57,590,090 L883P probably damaging Het
Zbbx T G 3: 75,052,414 D616A possibly damaging Het
Zfp943 T A 17: 21,992,823 C297S probably damaging Het
Other mutations in Fbxl13
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01722:Fbxl13 APN 5 21490414 missense possibly damaging 0.81
IGL02178:Fbxl13 APN 5 21620720 missense possibly damaging 0.56
IGL02271:Fbxl13 APN 5 21490456 missense probably damaging 1.00
IGL02317:Fbxl13 APN 5 21522234 missense probably benign 0.28
IGL02508:Fbxl13 APN 5 21556805 critical splice donor site probably null
IGL02891:Fbxl13 APN 5 21522100 splice site probably benign
IGL03387:Fbxl13 APN 5 21523798 critical splice donor site probably null
laurel UTSW 5 21582053 nonsense probably null
PIT4305001:Fbxl13 UTSW 5 21522148 missense probably benign
R0040:Fbxl13 UTSW 5 21486373 missense probably damaging 1.00
R0040:Fbxl13 UTSW 5 21486373 missense probably damaging 1.00
R0278:Fbxl13 UTSW 5 21523910 missense probably benign 0.03
R0597:Fbxl13 UTSW 5 21614714 missense probably benign 0.09
R1110:Fbxl13 UTSW 5 21484036 missense probably benign
R1172:Fbxl13 UTSW 5 21620604 splice site probably benign
R1175:Fbxl13 UTSW 5 21620604 splice site probably benign
R1464:Fbxl13 UTSW 5 21483991 missense probably benign 0.21
R1464:Fbxl13 UTSW 5 21483991 missense probably benign 0.21
R2426:Fbxl13 UTSW 5 21522137 missense probably damaging 1.00
R4171:Fbxl13 UTSW 5 21543788 missense probably benign 0.02
R4413:Fbxl13 UTSW 5 21582053 nonsense probably null
R4655:Fbxl13 UTSW 5 21582039 missense probably damaging 1.00
R4816:Fbxl13 UTSW 5 21484003 missense probably benign 0.25
R5544:Fbxl13 UTSW 5 21524491 missense probably damaging 0.96
R5979:Fbxl13 UTSW 5 21582091 missense probably damaging 1.00
R6176:Fbxl13 UTSW 5 21500500 missense possibly damaging 0.83
R6211:Fbxl13 UTSW 5 21484021 missense possibly damaging 0.57
R6252:Fbxl13 UTSW 5 21621501 missense possibly damaging 0.96
R6336:Fbxl13 UTSW 5 21523547 critical splice donor site probably null
R6455:Fbxl13 UTSW 5 21556814 missense probably benign 0.02
R6522:Fbxl13 UTSW 5 21561556 unclassified probably null
R6827:Fbxl13 UTSW 5 21522178 missense probably damaging 0.97
R6961:Fbxl13 UTSW 5 21543742 missense probably damaging 1.00
R6998:Fbxl13 UTSW 5 21543689 missense probably damaging 1.00
R6998:Fbxl13 UTSW 5 21620613 missense probably null 0.03
R7152:Fbxl13 UTSW 5 21582067 missense possibly damaging 0.95
R7196:Fbxl13 UTSW 5 21486303 missense probably damaging 0.97
R7418:Fbxl13 UTSW 5 21581983 missense probably benign 0.00
R7490:Fbxl13 UTSW 5 21523060 nonsense probably null
R7649:Fbxl13 UTSW 5 21614666 missense probably benign 0.13
R7816:Fbxl13 UTSW 5 21543787 missense probably benign 0.11
R8036:Fbxl13 UTSW 5 21523568 missense probably damaging 1.00
R8098:Fbxl13 UTSW 5 21620718 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- GGCAATGCTGGTGTTTCCC -3'
(R):5'- TTAGCTTCTTTTCTCGTTTGGAAA -3'

Sequencing Primer
(F):5'- TACAGGGATTTGTGACCACTAGCC -3'
(R):5'- CTTTTCTCGTTTGGAAATGATGAATC -3'
Posted On2014-10-02