Incidental Mutation 'R0178:Chrnb3'
ID23768
Institutional Source Beutler Lab
Gene Symbol Chrnb3
Ensembl Gene ENSMUSG00000031492
Gene Namecholinergic receptor, nicotinic, beta polypeptide 3
SynonymsAcrb3, 5730417K16Rik
MMRRC Submission 038446-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.084) question?
Stock #R0178 (G1)
Quality Score225
Status Validated (trace)
Chromosome8
Chromosomal Location27368711-27399730 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 27393364 bp
ZygosityHeterozygous
Amino Acid Change Valine to Aspartic acid at position 111 (V111D)
Ref Sequence ENSEMBL: ENSMUSP00000147672 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000060943] [ENSMUST00000079463] [ENSMUST00000211104]
Predicted Effect probably damaging
Transcript: ENSMUST00000060943
AA Change: V111D

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000052297
Gene: ENSMUSG00000031492
AA Change: V111D

DomainStartEndE-ValueType
Pfam:Neur_chan_LBD 35 239 2.3e-75 PFAM
Pfam:Neur_chan_memb 246 452 1.9e-65 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000079463
AA Change: V96D

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000078428
Gene: ENSMUSG00000031492
AA Change: V96D

DomainStartEndE-ValueType
Pfam:Neur_chan_LBD 35 224 1.3e-57 PFAM
Pfam:Neur_chan_memb 231 374 4.3e-48 PFAM
Pfam:Neur_chan_memb 349 437 9.7e-15 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000211104
AA Change: V111D

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Meta Mutation Damage Score 0.9138 question?
Coding Region Coverage
  • 1x: 98.9%
  • 3x: 98.1%
  • 10x: 95.5%
  • 20x: 88.8%
Validation Efficiency 95% (69/73)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The nicotinic acetylcholine receptors (nAChRs) are members of a superfamily of ligand-gated ion channels that mediate fast signal transmission at synapses. The nAChRs are (hetero)pentamers composed of homologous subunits. The subunits that make up the muscle and neuronal forms of nAChRs are encoded by separate genes and have different primary structure. There are several subtypes of neuronal nAChRs that vary based on which homologous subunits are arranged around the central channel. They are classified as alpha-subunits if, like muscle alpha-1 (MIM 100690), they have a pair of adjacent cysteines as part of the presumed acetylcholine binding site. Subunits lacking these cysteine residues are classified as beta-subunits (Groot Kormelink and Luyten, 1997 [PubMed 9009220]). Elliott et al. (1996) [PubMed 8906617] stated that the proposed structure for each subunit is a conserved N-terminal extracellular domain followed by 3 conserved transmembrane domains, a variable cytoplasmic loop, a fourth conserved transmembrane domain, and a short C-terminal extracellular region.[supplied by OMIM, Apr 2010]
PHENOTYPE: Mice homozygous for disruptions in this gene display hyperactivity and reflex abnormalities but were otherwise phenotypically normal. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 53 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700125H20Rik A G 11: 85,178,438 H94R probably benign Het
4922502D21Rik T C 6: 129,326,823 R60G probably benign Het
4930596D02Rik T G 14: 35,811,478 N111T probably benign Het
9930021J03Rik A G 19: 29,754,788 S342P probably damaging Het
Abca1 T C 4: 53,081,953 D769G possibly damaging Het
Adcy6 G T 15: 98,604,215 Q173K probably benign Het
Amotl1 G A 9: 14,548,773 A890V probably benign Het
Arfgap2 C T 2: 91,267,361 A141V probably benign Het
Asb2 G A 12: 103,325,552 P324L probably damaging Het
Cacna1g G A 11: 94,463,483 T202I probably damaging Het
Capn5 A G 7: 98,132,891 L214P probably damaging Het
Cdh20 A T 1: 104,975,051 D489V possibly damaging Het
Cers5 C A 15: 99,747,024 probably benign Het
Colec12 C T 18: 9,858,921 P568L unknown Het
Cyp2r1 T C 7: 114,550,408 E248G probably damaging Het
Dnmt3b A G 2: 153,675,018 T536A probably benign Het
Eef2 G A 10: 81,180,292 V496M possibly damaging Het
Fam118a T C 15: 85,045,880 probably benign Het
Fer1l6 T A 15: 58,637,914 probably null Het
Fhad1 A C 4: 141,955,340 F497V probably benign Het
Gbe1 G A 16: 70,478,386 G358D probably damaging Het
Gdf10 A G 14: 33,924,101 D69G probably damaging Het
Ggt6 A G 11: 72,436,818 H150R possibly damaging Het
Gm1966 A T 7: 106,601,821 Y739N probably damaging Het
Gm45713 A T 7: 45,134,458 L110Q probably damaging Het
Gm9847 T C 12: 14,494,648 noncoding transcript Het
Grwd1 T C 7: 45,830,630 E51G probably damaging Het
H13 A G 2: 152,681,067 Y100C probably damaging Het
Kcne1 A C 16: 92,348,809 M49R probably damaging Het
Kcnma1 C T 14: 23,526,767 R236H probably damaging Het
Knl1 T A 2: 119,058,405 probably benign Het
Krt40 T C 11: 99,541,739 I150M probably damaging Het
Ldb2 A T 5: 44,473,499 V300E probably damaging Het
Lrp1b A T 2: 40,725,907 C3606S probably damaging Het
Lrrc42 A G 4: 107,247,720 I16T probably damaging Het
Lrrc6 A C 15: 66,454,101 D208E probably benign Het
Mtus1 G T 8: 41,002,361 L87I possibly damaging Het
Myot T C 18: 44,336,986 F10S probably damaging Het
Nrg3 A T 14: 38,376,456 H480Q probably damaging Het
Olfr205 A T 16: 59,329,420 F30I probably damaging Het
Olfr691 G A 7: 105,336,922 R265C probably benign Het
Prl2c5 A T 13: 13,191,805 D220V probably damaging Het
Rbm17 G A 2: 11,587,779 S295L probably benign Het
Serpina6 A G 12: 103,646,913 I376T probably damaging Het
Sh2d2a A T 3: 87,849,423 T192S probably benign Het
Slc27a1 T C 8: 71,584,462 Y417H possibly damaging Het
Slc6a1 T G 6: 114,304,852 I32S possibly damaging Het
Sntb1 T C 15: 55,906,144 T150A probably damaging Het
Tanc1 T A 2: 59,835,447 C1183* probably null Het
Tmprss7 C A 16: 45,690,843 W57C probably damaging Het
Ubac1 A T 2: 26,021,428 V36E possibly damaging Het
Zfc3h1 T C 10: 115,406,725 probably benign Het
Zfp644 C T 5: 106,636,905 C592Y probably damaging Het
Other mutations in Chrnb3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00227:Chrnb3 APN 8 27385101 missense probably benign 0.13
IGL01655:Chrnb3 APN 8 27394174 missense probably damaging 1.00
IGL02124:Chrnb3 APN 8 27396804 unclassified probably benign
IGL02403:Chrnb3 APN 8 27393808 missense probably damaging 1.00
IGL02474:Chrnb3 APN 8 27393369 missense probably damaging 1.00
IGL02903:Chrnb3 APN 8 27386806 missense probably damaging 0.96
R0736:Chrnb3 UTSW 8 27385050 missense probably benign 0.00
R1695:Chrnb3 UTSW 8 27393700 missense probably damaging 1.00
R2051:Chrnb3 UTSW 8 27386811 missense probably damaging 1.00
R2091:Chrnb3 UTSW 8 27394234 missense probably damaging 1.00
R2313:Chrnb3 UTSW 8 27393781 missense probably damaging 1.00
R3020:Chrnb3 UTSW 8 27396784 missense probably benign
R3981:Chrnb3 UTSW 8 27394006 missense probably damaging 1.00
R4236:Chrnb3 UTSW 8 27393993 missense probably damaging 1.00
R4276:Chrnb3 UTSW 8 27393751 missense probably damaging 1.00
R4422:Chrnb3 UTSW 8 27396733 missense possibly damaging 0.84
R4515:Chrnb3 UTSW 8 27385090 missense probably damaging 1.00
R4688:Chrnb3 UTSW 8 27394119 missense probably damaging 1.00
R4931:Chrnb3 UTSW 8 27394230 missense probably damaging 0.99
R5164:Chrnb3 UTSW 8 27394132 missense probably damaging 1.00
R6333:Chrnb3 UTSW 8 27393327 missense probably damaging 0.96
R6454:Chrnb3 UTSW 8 27393375 missense probably damaging 1.00
R7070:Chrnb3 UTSW 8 27393961 missense probably damaging 1.00
R8060:Chrnb3 UTSW 8 27394560 missense unknown
R8156:Chrnb3 UTSW 8 27393654 missense probably benign 0.13
R8421:Chrnb3 UTSW 8 27396690 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GTATCCTGAAGCAGGGCTGAATCC -3'
(R):5'- TCCGTCAGCACTGCCATGAAAG -3'

Sequencing Primer
(F):5'- GAGGATACCACGTTTTAACCTGG -3'
(R):5'- AACACTCACTGTTTGGAGGC -3'
Posted On2013-04-16