Incidental Mutation 'R2174:Nlrp4a'
ID237693
Institutional Source Beutler Lab
Gene Symbol Nlrp4a
Ensembl Gene ENSMUSG00000040601
Gene NameNLR family, pyrin domain containing 4A
SynonymsE330028A19Rik, Nalp-eta, Nalp4a
MMRRC Submission 040176-MU
Accession Numbers

Genbank: NM_172896; MGI: 2443697

Is this an essential gene? Probably non essential (E-score: 0.091) question?
Stock #R2174 (G1)
Quality Score225
Status Validated
Chromosome7
Chromosomal Location26435113-26476142 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 26449424 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Proline at position 152 (L152P)
Ref Sequence ENSEMBL: ENSMUSP00000112441 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000068767] [ENSMUST00000119386] [ENSMUST00000146907]
Predicted Effect probably damaging
Transcript: ENSMUST00000068767
AA Change: L152P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000066841
Gene: ENSMUSG00000040601
AA Change: L152P

DomainStartEndE-ValueType
PYRIN 6 89 6.48e-34 SMART
Pfam:NACHT 148 317 4.9e-37 PFAM
Blast:LRR 634 661 4e-6 BLAST
low complexity region 666 677 N/A INTRINSIC
LRR 689 716 5.96e0 SMART
LRR 718 745 1.99e1 SMART
LRR 746 772 1.02e0 SMART
LRR 774 801 4.66e1 SMART
LRR 802 829 1.18e-2 SMART
LRR 831 858 2.2e-2 SMART
LRR 859 886 5.59e-4 SMART
LRR 888 915 9.41e0 SMART
LRR 916 943 8.94e1 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000119386
AA Change: L152P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000112441
Gene: ENSMUSG00000040601
AA Change: L152P

DomainStartEndE-ValueType
PYRIN 6 89 6.48e-34 SMART
Pfam:NACHT 148 317 1.3e-37 PFAM
Blast:LRR 634 661 4e-6 BLAST
low complexity region 666 677 N/A INTRINSIC
LRR 689 716 5.96e0 SMART
LRR 718 745 1.99e1 SMART
LRR 746 772 1.02e0 SMART
LRR 774 801 4.66e1 SMART
LRR 802 829 1.18e-2 SMART
LRR 831 858 2.2e-2 SMART
LRR 859 886 5.59e-4 SMART
LRR 888 915 9.41e0 SMART
LRR 916 943 8.94e1 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000146534
Predicted Effect probably damaging
Transcript: ENSMUST00000146907
AA Change: L152P

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
Meta Mutation Damage Score 0.6467 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.7%
Validation Efficiency 99% (73/74)
Allele List at MGI
Other mutations in this stock
Total: 72 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1600014C10Rik T C 7: 38,194,828 I95T possibly damaging Het
4930452B06Rik T C 14: 8,558,109 I159V probably benign Het
Adarb1 A G 10: 77,295,798 I619T probably benign Het
Aldh2 T C 5: 121,572,668 probably benign Het
Antxrl T A 14: 34,060,400 L180Q probably damaging Het
Asnsd1 A T 1: 53,347,601 I289N probably benign Het
Asxl3 T G 18: 22,453,644 S164A possibly damaging Het
Cacnb2 C T 2: 14,958,767 T108I probably benign Het
Capn2 A T 1: 182,479,725 I516N probably benign Het
Casc1 T C 6: 145,175,170 H641R probably damaging Het
Ccdc59 A T 10: 105,841,527 K9M possibly damaging Het
Cenpo T C 12: 4,217,318 K73R probably benign Het
Clasp1 A G 1: 118,560,095 H823R probably damaging Het
Col6a4 T C 9: 106,060,132 D1395G probably damaging Het
Ddx60 A G 8: 61,956,141 I404V probably damaging Het
Ddx60 G T 8: 62,017,200 M1407I probably benign Het
Dennd3 A T 15: 73,555,305 R844W probably damaging Het
Depdc1b A T 13: 108,362,253 K157* probably null Het
Dnajc1 T C 2: 18,307,951 D196G probably damaging Het
Fanca A G 8: 123,271,270 W1226R probably benign Het
Fbxl13 A G 5: 21,582,048 V297A possibly damaging Het
Fnta A T 8: 26,013,470 F96I possibly damaging Het
Fzd3 T C 14: 65,212,231 probably benign Het
Gckr T C 5: 31,327,009 V597A possibly damaging Het
Gm43302 T C 5: 105,274,350 K496R probably benign Het
Gm5283 A G 3: 17,230,841 noncoding transcript Het
Gm5724 A T 6: 141,727,593 Y406* probably null Het
Gm6741 A G 17: 91,236,904 I32V probably benign Het
Gnptab T A 10: 88,434,044 F870I probably damaging Het
Gpx8 G A 13: 113,045,606 P98S probably benign Het
Grm2 T C 9: 106,647,795 I574V probably benign Het
Gtf3c5 T C 2: 28,567,775 D468G probably benign Het
Hectd3 A T 4: 116,999,701 M482L probably benign Het
Ier5 G T 1: 155,098,853 P193H possibly damaging Het
Inpp4a A G 1: 37,396,130 N827S probably damaging Het
Kif13a A G 13: 46,769,176 L387P probably damaging Het
Map3k1 G C 13: 111,752,482 H1314D possibly damaging Het
Mbl2 G A 19: 30,234,012 C11Y possibly damaging Het
Msr1 A G 8: 39,631,340 L58P probably damaging Het
Mtmr10 T A 7: 64,336,764 F530Y possibly damaging Het
Myo7b A G 18: 31,983,557 L999P probably damaging Het
Myoz3 T C 18: 60,590,224 E8G probably benign Het
Naip6 C A 13: 100,298,987 M1009I probably benign Het
Nav2 T A 7: 49,452,663 M342K probably damaging Het
Ndufaf6 T C 4: 11,070,228 H131R probably benign Het
Olfr1413 A G 1: 92,573,657 N162S probably benign Het
Pan3 T C 5: 147,450,653 I144T possibly damaging Het
Prkdc A T 16: 15,734,922 Q2074L probably benign Het
Pthlh G A 6: 147,257,012 T150I probably benign Het
Ptprq A T 10: 107,705,553 Y371N probably damaging Het
Rfwd3 A G 8: 111,283,343 S377P probably damaging Het
Rpl31-ps17 C T 12: 54,701,612 noncoding transcript Het
Sap130 T C 18: 31,677,479 probably null Het
Sap25 T G 5: 137,642,629 M229R possibly damaging Het
Scaper A T 9: 55,859,037 V479E probably null Het
Scn3a T A 2: 65,507,206 D649V probably damaging Het
Smc1b A G 15: 85,121,851 probably benign Het
Sowahb T C 5: 93,044,425 E145G possibly damaging Het
Stxbp5 T A 10: 9,835,846 I277F possibly damaging Het
Tanc1 T C 2: 59,843,833 S1754P possibly damaging Het
Tanc2 A G 11: 105,910,309 D1117G probably benign Het
Tbc1d31 A G 15: 57,951,741 M605V possibly damaging Het
Tekt3 A T 11: 63,094,688 D440V possibly damaging Het
Tmem67 C T 4: 12,063,730 W477* probably null Het
Tra2a T C 6: 49,250,927 probably benign Het
Trappc12 A G 12: 28,747,381 F51L possibly damaging Het
Trrap C A 5: 144,821,855 P2183Q probably benign Het
Ubn2 T A 6: 38,470,141 probably null Het
Unc5d A T 8: 28,694,540 V644E probably damaging Het
Xpo4 A G 14: 57,590,090 L883P probably damaging Het
Zbbx T G 3: 75,052,414 D616A possibly damaging Het
Zfp943 T A 17: 21,992,823 C297S probably damaging Het
Other mutations in Nlrp4a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00487:Nlrp4a APN 7 26449985 missense possibly damaging 0.51
IGL00972:Nlrp4a APN 7 26457048 missense probably benign
IGL01081:Nlrp4a APN 7 26449829 missense probably benign 0.06
IGL01788:Nlrp4a APN 7 26454067 missense probably benign 0.17
IGL02001:Nlrp4a APN 7 26449969 missense probably benign 0.01
IGL02070:Nlrp4a APN 7 26449278 missense possibly damaging 0.77
IGL02175:Nlrp4a APN 7 26475097 missense probably damaging 1.00
IGL02193:Nlrp4a APN 7 26459692 missense probably damaging 1.00
IGL02193:Nlrp4a APN 7 26449278 missense possibly damaging 0.77
IGL02197:Nlrp4a APN 7 26449278 missense possibly damaging 0.77
IGL02200:Nlrp4a APN 7 26449278 missense possibly damaging 0.77
IGL02202:Nlrp4a APN 7 26449278 missense possibly damaging 0.77
IGL02207:Nlrp4a APN 7 26449278 missense possibly damaging 0.77
IGL02237:Nlrp4a APN 7 26449278 missense possibly damaging 0.77
IGL02240:Nlrp4a APN 7 26449278 missense possibly damaging 0.77
IGL02658:Nlrp4a APN 7 26449713 missense probably benign 0.43
IGL02743:Nlrp4a APN 7 26459815 splice site probably benign
IGL02960:Nlrp4a APN 7 26449730 missense probably benign 0.05
IGL03064:Nlrp4a APN 7 26449509 missense probably benign 0.23
IGL03276:Nlrp4a APN 7 26464190 missense probably damaging 1.00
BB002:Nlrp4a UTSW 7 26450586 missense probably benign 0.10
BB012:Nlrp4a UTSW 7 26450586 missense probably benign 0.10
D3080:Nlrp4a UTSW 7 26444341 missense probably benign 0.22
P0019:Nlrp4a UTSW 7 26449637 missense probably damaging 1.00
R0020:Nlrp4a UTSW 7 26450372 missense probably damaging 1.00
R0240:Nlrp4a UTSW 7 26462516 missense probably benign 0.00
R0240:Nlrp4a UTSW 7 26462516 missense probably benign 0.00
R0372:Nlrp4a UTSW 7 26449232 splice site probably benign
R0466:Nlrp4a UTSW 7 26462620 splice site probably benign
R0544:Nlrp4a UTSW 7 26457130 missense probably benign 0.00
R1006:Nlrp4a UTSW 7 26453467 missense probably benign 0.30
R1072:Nlrp4a UTSW 7 26444435 missense probably damaging 1.00
R1432:Nlrp4a UTSW 7 26464197 frame shift probably null
R1655:Nlrp4a UTSW 7 26449651 missense possibly damaging 0.56
R1696:Nlrp4a UTSW 7 26450534 missense probably damaging 1.00
R2041:Nlrp4a UTSW 7 26450186 missense probably damaging 0.97
R2091:Nlrp4a UTSW 7 26450153 missense probably damaging 1.00
R2163:Nlrp4a UTSW 7 26453397 missense probably benign 0.00
R2319:Nlrp4a UTSW 7 26449894 missense probably benign 0.10
R2358:Nlrp4a UTSW 7 26464198 missense probably benign 0.03
R2680:Nlrp4a UTSW 7 26449230 splice site probably null
R3812:Nlrp4a UTSW 7 26449693 missense probably benign
R4114:Nlrp4a UTSW 7 26449940 missense probably damaging 1.00
R4664:Nlrp4a UTSW 7 26449518 nonsense probably null
R4676:Nlrp4a UTSW 7 26450229 missense probably damaging 1.00
R4708:Nlrp4a UTSW 7 26464108 missense probably benign 0.00
R4728:Nlrp4a UTSW 7 26475090 missense probably benign 0.24
R4815:Nlrp4a UTSW 7 26450808 missense probably benign 0.00
R4831:Nlrp4a UTSW 7 26450419 missense possibly damaging 0.92
R5007:Nlrp4a UTSW 7 26462480 missense probably damaging 0.99
R5253:Nlrp4a UTSW 7 26450492 missense probably benign 0.00
R5262:Nlrp4a UTSW 7 26459811 critical splice donor site probably null
R5441:Nlrp4a UTSW 7 26454153 missense probably damaging 1.00
R5639:Nlrp4a UTSW 7 26457030 missense probably benign 0.02
R5641:Nlrp4a UTSW 7 26450164 missense probably damaging 1.00
R5771:Nlrp4a UTSW 7 26453389 missense probably damaging 1.00
R6312:Nlrp4a UTSW 7 26449396 missense probably benign 0.11
R7131:Nlrp4a UTSW 7 26449833 missense probably benign 0.21
R7149:Nlrp4a UTSW 7 26450438 missense probably benign 0.00
R7348:Nlrp4a UTSW 7 26444273 missense probably damaging 1.00
R7384:Nlrp4a UTSW 7 26449538 missense not run
R7548:Nlrp4a UTSW 7 26450179 missense probably damaging 1.00
R7566:Nlrp4a UTSW 7 26449245 critical splice acceptor site probably null
R7646:Nlrp4a UTSW 7 26449562 missense probably damaging 0.96
R7692:Nlrp4a UTSW 7 26449265 missense probably benign 0.01
R7902:Nlrp4a UTSW 7 26450057 missense possibly damaging 0.65
R7925:Nlrp4a UTSW 7 26450586 missense probably benign 0.10
R7937:Nlrp4a UTSW 7 26464146 missense probably benign 0.00
R7992:Nlrp4a UTSW 7 26450645 missense possibly damaging 0.51
R8205:Nlrp4a UTSW 7 26450794 missense probably benign
R8477:Nlrp4a UTSW 7 26459794 missense probably benign
R8704:Nlrp4a UTSW 7 26457138 missense probably benign 0.02
T0975:Nlrp4a UTSW 7 26449637 missense probably damaging 1.00
X0022:Nlrp4a UTSW 7 26444342 missense probably damaging 0.99
Z1088:Nlrp4a UTSW 7 26454163 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- CTGACTCAGGATGCCCAAAG -3'
(R):5'- CTCAGGTTTGGATAGTATCTCCTC -3'

Sequencing Primer
(F):5'- GGATGCCCAAAGTTATATCGAGCTC -3'
(R):5'- CTCCTCTATGGGAGCTGAGG -3'
Posted On2014-10-02