Incidental Mutation 'R2174:Ddx60'
ID 237701
Institutional Source Beutler Lab
Gene Symbol Ddx60
Ensembl Gene ENSMUSG00000037921
Gene Name DEAD (Asp-Glu-Ala-Asp) box polypeptide 60
Synonyms
MMRRC Submission 040176-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.145) question?
Stock # R2174 (G1)
Quality Score 225
Status Validated
Chromosome 8
Chromosomal Location 61928087-62038244 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 61956141 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Valine at position 404 (I404V)
Ref Sequence ENSEMBL: ENSMUSP00000122841 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000070631] [ENSMUST00000093485] [ENSMUST00000154398]
AlphaFold E9PZQ1
Predicted Effect probably damaging
Transcript: ENSMUST00000070631
AA Change: I404V

PolyPhen 2 Score 0.964 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000070741
Gene: ENSMUSG00000037921
AA Change: I404V

DomainStartEndE-ValueType
low complexity region 99 110 N/A INTRINSIC
low complexity region 364 376 N/A INTRINSIC
DEXDc 758 949 1.05e-15 SMART
Blast:DEXDc 1007 1132 4e-24 BLAST
HELICc 1245 1328 4.35e-13 SMART
low complexity region 1362 1373 N/A INTRINSIC
Blast:DEXDc 1503 1584 1e-20 BLAST
Predicted Effect probably damaging
Transcript: ENSMUST00000093485
AA Change: I404V

PolyPhen 2 Score 0.964 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000091197
Gene: ENSMUSG00000037921
AA Change: I404V

DomainStartEndE-ValueType
low complexity region 99 110 N/A INTRINSIC
low complexity region 364 376 N/A INTRINSIC
DEXDc 759 950 1.05e-15 SMART
Blast:DEXDc 1008 1133 4e-24 BLAST
HELICc 1246 1329 4.35e-13 SMART
low complexity region 1363 1374 N/A INTRINSIC
Blast:DEXDc 1504 1585 1e-20 BLAST
Predicted Effect probably damaging
Transcript: ENSMUST00000154398
AA Change: I404V

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000122841
Gene: ENSMUSG00000037921
AA Change: I404V

DomainStartEndE-ValueType
low complexity region 99 110 N/A INTRINSIC
low complexity region 364 376 N/A INTRINSIC
Meta Mutation Damage Score 0.0942 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.7%
Validation Efficiency 99% (73/74)
MGI Phenotype PHENOTYPE: Mice homozygous for a knock-out allele exhibit normal immunity to several viruses (IAV, EMCV, SINV) but increased susceptibility to VSV infection. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 71 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1600014C10Rik T C 7: 38,194,828 (GRCm38) I95T possibly damaging Het
4930452B06Rik T C 14: 8,558,109 (GRCm38) I159V probably benign Het
Adarb1 A G 10: 77,295,798 (GRCm38) I619T probably benign Het
Aldh2 T C 5: 121,572,668 (GRCm38) probably benign Het
Antxrl T A 14: 34,060,400 (GRCm38) L180Q probably damaging Het
Asnsd1 A T 1: 53,347,601 (GRCm38) I289N probably benign Het
Asxl3 T G 18: 22,453,644 (GRCm38) S164A possibly damaging Het
Cacnb2 C T 2: 14,958,767 (GRCm38) T108I probably benign Het
Capn2 A T 1: 182,479,725 (GRCm38) I516N probably benign Het
Casc1 T C 6: 145,175,170 (GRCm38) H641R probably damaging Het
Ccdc59 A T 10: 105,841,527 (GRCm38) K9M possibly damaging Het
Cenpo T C 12: 4,217,318 (GRCm38) K73R probably benign Het
Clasp1 A G 1: 118,560,095 (GRCm38) H823R probably damaging Het
Col6a4 T C 9: 106,060,132 (GRCm38) D1395G probably damaging Het
Dennd3 A T 15: 73,555,305 (GRCm38) R844W probably damaging Het
Depdc1b A T 13: 108,362,253 (GRCm38) K157* probably null Het
Dnajc1 T C 2: 18,307,951 (GRCm38) D196G probably damaging Het
Fanca A G 8: 123,271,270 (GRCm38) W1226R probably benign Het
Fbxl13 A G 5: 21,582,048 (GRCm38) V297A possibly damaging Het
Fnta A T 8: 26,013,470 (GRCm38) F96I possibly damaging Het
Fzd3 T C 14: 65,212,231 (GRCm38) probably benign Het
Gckr T C 5: 31,327,009 (GRCm38) V597A possibly damaging Het
Gm43302 T C 5: 105,274,350 (GRCm38) K496R probably benign Het
Gm5283 A G 3: 17,230,841 (GRCm38) noncoding transcript Het
Gm5724 A T 6: 141,727,593 (GRCm38) Y406* probably null Het
Gm6741 A G 17: 91,236,904 (GRCm38) I32V probably benign Het
Gnptab T A 10: 88,434,044 (GRCm38) F870I probably damaging Het
Gpx8 G A 13: 113,045,606 (GRCm38) P98S probably benign Het
Grm2 T C 9: 106,647,795 (GRCm38) I574V probably benign Het
Gtf3c5 T C 2: 28,567,775 (GRCm38) D468G probably benign Het
Hectd3 A T 4: 116,999,701 (GRCm38) M482L probably benign Het
Ier5 G T 1: 155,098,853 (GRCm38) P193H possibly damaging Het
Inpp4a A G 1: 37,396,130 (GRCm38) N827S probably damaging Het
Kif13a A G 13: 46,769,176 (GRCm38) L387P probably damaging Het
Map3k1 G C 13: 111,752,482 (GRCm38) H1314D possibly damaging Het
Mbl2 G A 19: 30,234,012 (GRCm38) C11Y possibly damaging Het
Msr1 A G 8: 39,631,340 (GRCm38) L58P probably damaging Het
Mtmr10 T A 7: 64,336,764 (GRCm38) F530Y possibly damaging Het
Myo7b A G 18: 31,983,557 (GRCm38) L999P probably damaging Het
Myoz3 T C 18: 60,590,224 (GRCm38) E8G probably benign Het
Naip6 C A 13: 100,298,987 (GRCm38) M1009I probably benign Het
Nav2 T A 7: 49,452,663 (GRCm38) M342K probably damaging Het
Ndufaf6 T C 4: 11,070,228 (GRCm38) H131R probably benign Het
Nlrp4a T C 7: 26,449,424 (GRCm38) L152P probably damaging Het
Olfr1413 A G 1: 92,573,657 (GRCm38) N162S probably benign Het
Pan3 T C 5: 147,450,653 (GRCm38) I144T possibly damaging Het
Prkdc A T 16: 15,734,922 (GRCm38) Q2074L probably benign Het
Pthlh G A 6: 147,257,012 (GRCm38) T150I probably benign Het
Ptprq A T 10: 107,705,553 (GRCm38) Y371N probably damaging Het
Rfwd3 A G 8: 111,283,343 (GRCm38) S377P probably damaging Het
Rpl31-ps17 C T 12: 54,701,612 (GRCm38) noncoding transcript Het
Sap130 T C 18: 31,677,479 (GRCm38) probably null Het
Sap25 T G 5: 137,642,629 (GRCm38) M229R possibly damaging Het
Scaper A T 9: 55,859,037 (GRCm38) V479E probably null Het
Scn3a T A 2: 65,507,206 (GRCm38) D649V probably damaging Het
Smc1b A G 15: 85,121,851 (GRCm38) probably benign Het
Sowahb T C 5: 93,044,425 (GRCm38) E145G possibly damaging Het
Stxbp5 T A 10: 9,835,846 (GRCm38) I277F possibly damaging Het
Tanc1 T C 2: 59,843,833 (GRCm38) S1754P possibly damaging Het
Tanc2 A G 11: 105,910,309 (GRCm38) D1117G probably benign Het
Tbc1d31 A G 15: 57,951,741 (GRCm38) M605V possibly damaging Het
Tekt3 A T 11: 63,094,688 (GRCm38) D440V possibly damaging Het
Tmem67 C T 4: 12,063,730 (GRCm38) W477* probably null Het
Tra2a T C 6: 49,250,927 (GRCm38) probably benign Het
Trappc12 A G 12: 28,747,381 (GRCm38) F51L possibly damaging Het
Trrap C A 5: 144,821,855 (GRCm38) P2183Q probably benign Het
Ubn2 T A 6: 38,470,141 (GRCm38) probably null Het
Unc5d A T 8: 28,694,540 (GRCm38) V644E probably damaging Het
Xpo4 A G 14: 57,590,090 (GRCm38) L883P probably damaging Het
Zbbx T G 3: 75,052,414 (GRCm38) D616A possibly damaging Het
Zfp943 T A 17: 21,992,823 (GRCm38) C297S probably damaging Het
Other mutations in Ddx60
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00340:Ddx60 APN 8 61,958,646 (GRCm38) missense probably damaging 1.00
IGL00915:Ddx60 APN 8 61,987,431 (GRCm38) missense possibly damaging 0.79
IGL00931:Ddx60 APN 8 61,969,583 (GRCm38) missense probably benign 0.18
IGL01023:Ddx60 APN 8 61,942,514 (GRCm38) missense probably damaging 0.99
IGL01313:Ddx60 APN 8 61,982,526 (GRCm38) missense probably damaging 1.00
IGL01615:Ddx60 APN 8 61,963,740 (GRCm38) missense probably null 0.81
IGL01733:Ddx60 APN 8 61,983,865 (GRCm38) missense probably damaging 0.99
IGL01779:Ddx60 APN 8 62,017,823 (GRCm38) missense possibly damaging 0.94
IGL01900:Ddx60 APN 8 62,000,709 (GRCm38) splice site probably benign
IGL02110:Ddx60 APN 8 62,017,247 (GRCm38) critical splice donor site probably null
IGL02302:Ddx60 APN 8 61,975,832 (GRCm38) missense possibly damaging 0.85
IGL02468:Ddx60 APN 8 61,958,642 (GRCm38) missense probably damaging 1.00
IGL02569:Ddx60 APN 8 62,024,951 (GRCm38) missense possibly damaging 0.93
IGL02622:Ddx60 APN 8 61,942,436 (GRCm38) splice site probably null
IGL02657:Ddx60 APN 8 61,984,115 (GRCm38) missense probably benign 0.01
IGL02677:Ddx60 APN 8 61,988,132 (GRCm38) missense probably damaging 1.00
IGL02701:Ddx60 APN 8 61,979,341 (GRCm38) missense probably damaging 0.96
IGL02806:Ddx60 APN 8 61,956,122 (GRCm38) missense probably benign 0.00
IGL03137:Ddx60 APN 8 61,988,083 (GRCm38) missense possibly damaging 0.61
IGL03295:Ddx60 APN 8 61,956,121 (GRCm38) missense possibly damaging 0.82
IGL03387:Ddx60 APN 8 62,012,449 (GRCm38) missense probably damaging 1.00
IGL03411:Ddx60 APN 8 61,977,882 (GRCm38) critical splice acceptor site probably null
Scatter UTSW 8 62,021,314 (GRCm38) missense possibly damaging 0.80
shotgun UTSW 8 62,037,067 (GRCm38) missense probably benign 0.28
splay UTSW 8 62,021,309 (GRCm38) missense possibly damaging 0.80
G1Funyon:Ddx60 UTSW 8 62,000,597 (GRCm38) missense probably benign 0.01
PIT4504001:Ddx60 UTSW 8 61,958,113 (GRCm38) missense probably benign
PIT4677001:Ddx60 UTSW 8 61,972,254 (GRCm38) missense possibly damaging 0.87
R0090:Ddx60 UTSW 8 61,942,293 (GRCm38) missense probably damaging 1.00
R0266:Ddx60 UTSW 8 62,033,493 (GRCm38) missense possibly damaging 0.92
R0325:Ddx60 UTSW 8 61,983,855 (GRCm38) missense probably benign 0.00
R0367:Ddx60 UTSW 8 62,017,749 (GRCm38) missense possibly damaging 0.78
R0403:Ddx60 UTSW 8 61,994,541 (GRCm38) splice site probably benign
R0479:Ddx60 UTSW 8 61,969,657 (GRCm38) missense probably damaging 1.00
R0561:Ddx60 UTSW 8 62,017,794 (GRCm38) missense possibly damaging 0.93
R0844:Ddx60 UTSW 8 61,987,361 (GRCm38) missense probably benign 0.27
R1119:Ddx60 UTSW 8 61,942,544 (GRCm38) missense probably damaging 1.00
R1428:Ddx60 UTSW 8 61,958,159 (GRCm38) splice site probably benign
R1778:Ddx60 UTSW 8 61,974,176 (GRCm38) missense possibly damaging 0.85
R1840:Ddx60 UTSW 8 61,969,553 (GRCm38) missense probably damaging 0.99
R1964:Ddx60 UTSW 8 61,948,869 (GRCm38) missense probably benign 0.10
R1970:Ddx60 UTSW 8 61,972,206 (GRCm38) missense possibly damaging 0.93
R2101:Ddx60 UTSW 8 61,940,645 (GRCm38) missense probably damaging 1.00
R2174:Ddx60 UTSW 8 62,017,200 (GRCm38) missense probably benign 0.01
R2198:Ddx60 UTSW 8 61,958,063 (GRCm38) missense possibly damaging 0.79
R2332:Ddx60 UTSW 8 62,037,091 (GRCm38) missense probably benign 0.08
R2338:Ddx60 UTSW 8 62,012,436 (GRCm38) missense possibly damaging 0.91
R2379:Ddx60 UTSW 8 62,037,088 (GRCm38) missense probably damaging 1.00
R4010:Ddx60 UTSW 8 61,956,144 (GRCm38) missense probably benign 0.25
R4010:Ddx60 UTSW 8 61,954,535 (GRCm38) missense possibly damaging 0.65
R4133:Ddx60 UTSW 8 61,972,220 (GRCm38) missense probably damaging 0.99
R4282:Ddx60 UTSW 8 61,994,393 (GRCm38) missense probably damaging 0.99
R4382:Ddx60 UTSW 8 61,948,978 (GRCm38) splice site probably null
R4561:Ddx60 UTSW 8 61,942,461 (GRCm38) missense probably damaging 0.96
R4572:Ddx60 UTSW 8 61,987,421 (GRCm38) missense probably damaging 1.00
R4581:Ddx60 UTSW 8 62,023,261 (GRCm38) missense possibly damaging 0.90
R4635:Ddx60 UTSW 8 62,037,067 (GRCm38) missense probably benign 0.28
R4698:Ddx60 UTSW 8 62,012,424 (GRCm38) missense probably benign 0.01
R4807:Ddx60 UTSW 8 61,979,338 (GRCm38) missense probably damaging 1.00
R4858:Ddx60 UTSW 8 62,021,314 (GRCm38) missense possibly damaging 0.80
R4964:Ddx60 UTSW 8 61,979,338 (GRCm38) missense probably damaging 1.00
R5120:Ddx60 UTSW 8 61,945,906 (GRCm38) missense probably benign 0.01
R5187:Ddx60 UTSW 8 61,974,188 (GRCm38) missense probably damaging 1.00
R5222:Ddx60 UTSW 8 61,984,158 (GRCm38) missense probably damaging 0.99
R5400:Ddx60 UTSW 8 62,010,002 (GRCm38) missense possibly damaging 0.65
R5500:Ddx60 UTSW 8 61,950,451 (GRCm38) missense probably benign 0.28
R5514:Ddx60 UTSW 8 61,958,057 (GRCm38) missense probably damaging 1.00
R5668:Ddx60 UTSW 8 62,000,578 (GRCm38) missense probably benign 0.38
R5742:Ddx60 UTSW 8 61,948,921 (GRCm38) missense probably benign
R5772:Ddx60 UTSW 8 61,948,897 (GRCm38) missense probably damaging 1.00
R5810:Ddx60 UTSW 8 62,012,388 (GRCm38) nonsense probably null
R5815:Ddx60 UTSW 8 61,963,722 (GRCm38) missense probably damaging 0.98
R5820:Ddx60 UTSW 8 61,956,121 (GRCm38) missense possibly damaging 0.82
R5866:Ddx60 UTSW 8 61,940,740 (GRCm38) missense probably damaging 1.00
R5881:Ddx60 UTSW 8 62,037,070 (GRCm38) missense probably damaging 1.00
R5977:Ddx60 UTSW 8 62,021,410 (GRCm38) critical splice donor site probably null
R6048:Ddx60 UTSW 8 62,000,582 (GRCm38) missense probably benign 0.01
R6061:Ddx60 UTSW 8 62,023,241 (GRCm38) missense probably null 0.01
R6153:Ddx60 UTSW 8 61,945,940 (GRCm38) missense possibly damaging 0.47
R6287:Ddx60 UTSW 8 61,950,578 (GRCm38) missense probably damaging 1.00
R6415:Ddx60 UTSW 8 61,983,905 (GRCm38) missense probably benign 0.00
R6416:Ddx60 UTSW 8 61,998,681 (GRCm38) missense probably benign
R6416:Ddx60 UTSW 8 61,977,950 (GRCm38) missense probably benign 0.00
R6660:Ddx60 UTSW 8 61,956,239 (GRCm38) missense probably benign 0.00
R6694:Ddx60 UTSW 8 62,037,070 (GRCm38) missense probably damaging 1.00
R6715:Ddx60 UTSW 8 61,983,890 (GRCm38) missense probably benign 0.03
R6720:Ddx60 UTSW 8 62,000,689 (GRCm38) missense probably benign 0.10
R6937:Ddx60 UTSW 8 62,037,069 (GRCm38) missense probably damaging 1.00
R7153:Ddx60 UTSW 8 61,988,108 (GRCm38) missense possibly damaging 0.71
R7274:Ddx60 UTSW 8 61,940,108 (GRCm38) critical splice donor site probably null
R7409:Ddx60 UTSW 8 61,958,578 (GRCm38) missense probably benign 0.24
R7464:Ddx60 UTSW 8 61,940,674 (GRCm38) missense possibly damaging 0.82
R7670:Ddx60 UTSW 8 61,975,792 (GRCm38) missense probably damaging 1.00
R7904:Ddx60 UTSW 8 61,977,890 (GRCm38) missense possibly damaging 0.81
R7992:Ddx60 UTSW 8 61,954,535 (GRCm38) missense probably benign 0.03
R8124:Ddx60 UTSW 8 61,983,911 (GRCm38) missense probably benign
R8125:Ddx60 UTSW 8 61,983,911 (GRCm38) missense probably benign
R8126:Ddx60 UTSW 8 61,983,911 (GRCm38) missense probably benign
R8155:Ddx60 UTSW 8 62,017,171 (GRCm38) missense possibly damaging 0.61
R8174:Ddx60 UTSW 8 62,017,250 (GRCm38) splice site probably null
R8192:Ddx60 UTSW 8 61,977,968 (GRCm38) missense probably damaging 1.00
R8271:Ddx60 UTSW 8 61,940,108 (GRCm38) critical splice donor site probably null
R8301:Ddx60 UTSW 8 62,000,597 (GRCm38) missense probably benign 0.01
R8304:Ddx60 UTSW 8 61,998,769 (GRCm38) missense possibly damaging 0.67
R8319:Ddx60 UTSW 8 61,942,635 (GRCm38) critical splice donor site probably null
R8374:Ddx60 UTSW 8 61,974,171 (GRCm38) missense probably benign 0.01
R8401:Ddx60 UTSW 8 61,956,243 (GRCm38) missense possibly damaging 0.57
R8487:Ddx60 UTSW 8 61,974,150 (GRCm38) missense probably damaging 1.00
R8804:Ddx60 UTSW 8 61,958,606 (GRCm38) missense probably benign 0.27
R8826:Ddx60 UTSW 8 61,945,956 (GRCm38) missense probably benign 0.02
R8829:Ddx60 UTSW 8 61,940,661 (GRCm38) missense probably damaging 1.00
R8881:Ddx60 UTSW 8 62,021,309 (GRCm38) missense possibly damaging 0.80
R8884:Ddx60 UTSW 8 61,994,519 (GRCm38) missense possibly damaging 0.86
R8990:Ddx60 UTSW 8 61,974,134 (GRCm38) nonsense probably null
R9122:Ddx60 UTSW 8 61,989,864 (GRCm38) missense probably benign 0.16
R9225:Ddx60 UTSW 8 62,017,841 (GRCm38) missense probably benign 0.36
R9278:Ddx60 UTSW 8 61,977,978 (GRCm38) missense possibly damaging 0.83
R9293:Ddx60 UTSW 8 62,009,960 (GRCm38) missense possibly damaging 0.89
R9405:Ddx60 UTSW 8 61,972,214 (GRCm38) missense probably benign 0.03
R9766:Ddx60 UTSW 8 62,012,278 (GRCm38) missense probably damaging 1.00
X0003:Ddx60 UTSW 8 62,033,417 (GRCm38) missense possibly damaging 0.88
X0019:Ddx60 UTSW 8 61,963,692 (GRCm38) missense probably benign 0.01
Z1177:Ddx60 UTSW 8 62,000,588 (GRCm38) missense possibly damaging 0.92
Predicted Primers PCR Primer
(F):5'- TGCCTCGTATTTCAGAGCAGG -3'
(R):5'- TTAATATGAGTCAAAGCACACACTAGC -3'

Sequencing Primer
(F):5'- CTCGTATTTCAGAGCAGGCTGAC -3'
(R):5'- CACACAAAAATGATTTCTACTTGGAG -3'
Posted On 2014-10-02