Incidental Mutation 'R0178:1700125H20Rik'
ID23771
Institutional Source Beutler Lab
Gene Symbol 1700125H20Rik
Ensembl Gene ENSMUSG00000018479
Gene NameRIKEN cDNA 1700125H20 gene
Synonyms
MMRRC Submission 038446-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.078) question?
Stock #R0178 (G1)
Quality Score216
Status Validated (trace)
Chromosome11
Chromosomal Location85170404-85181145 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 85178438 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Arginine at position 94 (H94R)
Ref Sequence ENSEMBL: ENSMUSP00000098248 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000018623] [ENSMUST00000100681]
Predicted Effect probably benign
Transcript: ENSMUST00000018623
AA Change: H204R

PolyPhen 2 Score 0.089 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000018623
Gene: ENSMUSG00000018479
AA Change: H204R

DomainStartEndE-ValueType
DUF4208 31 134 1.43e-35 SMART
low complexity region 211 230 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000100681
AA Change: H94R

PolyPhen 2 Score 0.089 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000098248
Gene: ENSMUSG00000018479
AA Change: H94R

DomainStartEndE-ValueType
Blast:DUF4208 1 24 1e-7 BLAST
low complexity region 101 120 N/A INTRINSIC
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 98.9%
  • 3x: 98.1%
  • 10x: 95.5%
  • 20x: 88.8%
Validation Efficiency 95% (69/73)
Allele List at MGI
Other mutations in this stock
Total: 53 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4922502D21Rik T C 6: 129,326,823 R60G probably benign Het
4930596D02Rik T G 14: 35,811,478 N111T probably benign Het
9930021J03Rik A G 19: 29,754,788 S342P probably damaging Het
Abca1 T C 4: 53,081,953 D769G possibly damaging Het
Adcy6 G T 15: 98,604,215 Q173K probably benign Het
Amotl1 G A 9: 14,548,773 A890V probably benign Het
Arfgap2 C T 2: 91,267,361 A141V probably benign Het
Asb2 G A 12: 103,325,552 P324L probably damaging Het
Cacna1g G A 11: 94,463,483 T202I probably damaging Het
Capn5 A G 7: 98,132,891 L214P probably damaging Het
Cdh20 A T 1: 104,975,051 D489V possibly damaging Het
Cers5 C A 15: 99,747,024 probably benign Het
Chrnb3 T A 8: 27,393,364 V111D probably damaging Het
Colec12 C T 18: 9,858,921 P568L unknown Het
Cyp2r1 T C 7: 114,550,408 E248G probably damaging Het
Dnmt3b A G 2: 153,675,018 T536A probably benign Het
Eef2 G A 10: 81,180,292 V496M possibly damaging Het
Fam118a T C 15: 85,045,880 probably benign Het
Fer1l6 T A 15: 58,637,914 probably null Het
Fhad1 A C 4: 141,955,340 F497V probably benign Het
Gbe1 G A 16: 70,478,386 G358D probably damaging Het
Gdf10 A G 14: 33,924,101 D69G probably damaging Het
Ggt6 A G 11: 72,436,818 H150R possibly damaging Het
Gm1966 A T 7: 106,601,821 Y739N probably damaging Het
Gm45713 A T 7: 45,134,458 L110Q probably damaging Het
Gm9847 T C 12: 14,494,648 noncoding transcript Het
Grwd1 T C 7: 45,830,630 E51G probably damaging Het
H13 A G 2: 152,681,067 Y100C probably damaging Het
Kcne1 A C 16: 92,348,809 M49R probably damaging Het
Kcnma1 C T 14: 23,526,767 R236H probably damaging Het
Knl1 T A 2: 119,058,405 probably benign Het
Krt40 T C 11: 99,541,739 I150M probably damaging Het
Ldb2 A T 5: 44,473,499 V300E probably damaging Het
Lrp1b A T 2: 40,725,907 C3606S probably damaging Het
Lrrc42 A G 4: 107,247,720 I16T probably damaging Het
Lrrc6 A C 15: 66,454,101 D208E probably benign Het
Mtus1 G T 8: 41,002,361 L87I possibly damaging Het
Myot T C 18: 44,336,986 F10S probably damaging Het
Nrg3 A T 14: 38,376,456 H480Q probably damaging Het
Olfr205 A T 16: 59,329,420 F30I probably damaging Het
Olfr691 G A 7: 105,336,922 R265C probably benign Het
Prl2c5 A T 13: 13,191,805 D220V probably damaging Het
Rbm17 G A 2: 11,587,779 S295L probably benign Het
Serpina6 A G 12: 103,646,913 I376T probably damaging Het
Sh2d2a A T 3: 87,849,423 T192S probably benign Het
Slc27a1 T C 8: 71,584,462 Y417H possibly damaging Het
Slc6a1 T G 6: 114,304,852 I32S possibly damaging Het
Sntb1 T C 15: 55,906,144 T150A probably damaging Het
Tanc1 T A 2: 59,835,447 C1183* probably null Het
Tmprss7 C A 16: 45,690,843 W57C probably damaging Het
Ubac1 A T 2: 26,021,428 V36E possibly damaging Het
Zfc3h1 T C 10: 115,406,725 probably benign Het
Zfp644 C T 5: 106,636,905 C592Y probably damaging Het
Other mutations in 1700125H20Rik
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01490:1700125H20Rik APN 11 85178312 missense probably damaging 0.97
IGL01745:1700125H20Rik APN 11 85172870 missense probably benign 0.02
R1614:1700125H20Rik UTSW 11 85172864 missense possibly damaging 0.46
R3161:1700125H20Rik UTSW 11 85173284 missense probably damaging 0.98
R5707:1700125H20Rik UTSW 11 85173312 missense probably benign 0.39
R5796:1700125H20Rik UTSW 11 85173275 missense probably null 0.77
R6033:1700125H20Rik UTSW 11 85178372 missense probably damaging 1.00
R6033:1700125H20Rik UTSW 11 85178372 missense probably damaging 1.00
X0066:1700125H20Rik UTSW 11 85178349 missense probably benign 0.05
Predicted Primers PCR Primer
(F):5'- TGGATTCCATTTCAGGCCGCAC -3'
(R):5'- CAGCTTCTCAGTCCACTGTCCAAG -3'

Sequencing Primer
(F):5'- GCACTCTGCCCCTTGGATG -3'
(R):5'- AGGCTTTCCCCCAGTGTC -3'
Posted On2013-04-16