Incidental Mutation 'R0178:Krt40'
ID23773
Institutional Source Beutler Lab
Gene Symbol Krt40
Ensembl Gene ENSMUSG00000059169
Gene Namekeratin 40
SynonymsKa36
MMRRC Submission 038446-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.085) question?
Stock #R0178 (G1)
Quality Score225
Status Validated (trace)
Chromosome11
Chromosomal Location99537485-99543158 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 99541739 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Methionine at position 150 (I150M)
Ref Sequence ENSEMBL: ENSMUSP00000073869 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000074253] [ENSMUST00000107443]
Predicted Effect probably damaging
Transcript: ENSMUST00000074253
AA Change: I150M

PolyPhen 2 Score 0.993 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000073869
Gene: ENSMUSG00000059169
AA Change: I150M

DomainStartEndE-ValueType
low complexity region 28 41 N/A INTRINSIC
Filament 88 399 1.07e-139 SMART
internal_repeat_1 409 419 9.76e-5 PROSPERO
internal_repeat_1 417 427 9.76e-5 PROSPERO
Predicted Effect probably benign
Transcript: ENSMUST00000107443
SMART Domains Protein: ENSMUSP00000103067
Gene: ENSMUSG00000059169

DomainStartEndE-ValueType
low complexity region 28 41 N/A INTRINSIC
Pfam:Filament 88 149 4.8e-19 PFAM
Pfam:Filament 146 319 6.1e-50 PFAM
Meta Mutation Damage Score 0.6467 question?
Coding Region Coverage
  • 1x: 98.9%
  • 3x: 98.1%
  • 10x: 95.5%
  • 20x: 88.8%
Validation Efficiency 95% (69/73)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the type I (acidic) keratin family, which belongs to the superfamily of intermediate filament (IF) proteins. Keratins are heteropolymeric structural proteins which form the intermediate filament. These filaments, along with actin microfilaments and microtubules, compose the cytoskeleton of epithelial cells. The type I keratin genes are clustered in a region of chromosome 17q12-q21. [provided by RefSeq, Jul 2009]
Allele List at MGI
Other mutations in this stock
Total: 53 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700125H20Rik A G 11: 85,178,438 H94R probably benign Het
4922502D21Rik T C 6: 129,326,823 R60G probably benign Het
4930596D02Rik T G 14: 35,811,478 N111T probably benign Het
9930021J03Rik A G 19: 29,754,788 S342P probably damaging Het
Abca1 T C 4: 53,081,953 D769G possibly damaging Het
Adcy6 G T 15: 98,604,215 Q173K probably benign Het
Amotl1 G A 9: 14,548,773 A890V probably benign Het
Arfgap2 C T 2: 91,267,361 A141V probably benign Het
Asb2 G A 12: 103,325,552 P324L probably damaging Het
Cacna1g G A 11: 94,463,483 T202I probably damaging Het
Capn5 A G 7: 98,132,891 L214P probably damaging Het
Cdh20 A T 1: 104,975,051 D489V possibly damaging Het
Cers5 C A 15: 99,747,024 probably benign Het
Chrnb3 T A 8: 27,393,364 V111D probably damaging Het
Colec12 C T 18: 9,858,921 P568L unknown Het
Cyp2r1 T C 7: 114,550,408 E248G probably damaging Het
Dnmt3b A G 2: 153,675,018 T536A probably benign Het
Eef2 G A 10: 81,180,292 V496M possibly damaging Het
Fam118a T C 15: 85,045,880 probably benign Het
Fer1l6 T A 15: 58,637,914 probably null Het
Fhad1 A C 4: 141,955,340 F497V probably benign Het
Gbe1 G A 16: 70,478,386 G358D probably damaging Het
Gdf10 A G 14: 33,924,101 D69G probably damaging Het
Ggt6 A G 11: 72,436,818 H150R possibly damaging Het
Gm1966 A T 7: 106,601,821 Y739N probably damaging Het
Gm45713 A T 7: 45,134,458 L110Q probably damaging Het
Gm9847 T C 12: 14,494,648 noncoding transcript Het
Grwd1 T C 7: 45,830,630 E51G probably damaging Het
H13 A G 2: 152,681,067 Y100C probably damaging Het
Kcne1 A C 16: 92,348,809 M49R probably damaging Het
Kcnma1 C T 14: 23,526,767 R236H probably damaging Het
Knl1 T A 2: 119,058,405 probably benign Het
Ldb2 A T 5: 44,473,499 V300E probably damaging Het
Lrp1b A T 2: 40,725,907 C3606S probably damaging Het
Lrrc42 A G 4: 107,247,720 I16T probably damaging Het
Lrrc6 A C 15: 66,454,101 D208E probably benign Het
Mtus1 G T 8: 41,002,361 L87I possibly damaging Het
Myot T C 18: 44,336,986 F10S probably damaging Het
Nrg3 A T 14: 38,376,456 H480Q probably damaging Het
Olfr205 A T 16: 59,329,420 F30I probably damaging Het
Olfr691 G A 7: 105,336,922 R265C probably benign Het
Prl2c5 A T 13: 13,191,805 D220V probably damaging Het
Rbm17 G A 2: 11,587,779 S295L probably benign Het
Serpina6 A G 12: 103,646,913 I376T probably damaging Het
Sh2d2a A T 3: 87,849,423 T192S probably benign Het
Slc27a1 T C 8: 71,584,462 Y417H possibly damaging Het
Slc6a1 T G 6: 114,304,852 I32S possibly damaging Het
Sntb1 T C 15: 55,906,144 T150A probably damaging Het
Tanc1 T A 2: 59,835,447 C1183* probably null Het
Tmprss7 C A 16: 45,690,843 W57C probably damaging Het
Ubac1 A T 2: 26,021,428 V36E possibly damaging Het
Zfc3h1 T C 10: 115,406,725 probably benign Het
Zfp644 C T 5: 106,636,905 C592Y probably damaging Het
Other mutations in Krt40
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01407:Krt40 APN 11 99541219 missense probably damaging 1.00
IGL01483:Krt40 APN 11 99542727 missense probably damaging 1.00
IGL01621:Krt40 APN 11 99542868 missense probably damaging 1.00
IGL01921:Krt40 APN 11 99543163 unclassified probably benign
IGL02095:Krt40 APN 11 99541671 missense probably damaging 0.98
IGL02735:Krt40 APN 11 99538635 missense probably damaging 1.00
IGL02960:Krt40 APN 11 99539867 splice site probably null
IGL02965:Krt40 APN 11 99541666 missense probably damaging 1.00
IGL03168:Krt40 APN 11 99543028 missense possibly damaging 0.87
IGL03240:Krt40 APN 11 99537568 missense probably damaging 1.00
IGL03387:Krt40 APN 11 99539885 missense probably damaging 1.00
R0242:Krt40 UTSW 11 99538742 missense probably damaging 1.00
R0242:Krt40 UTSW 11 99538742 missense probably damaging 1.00
R0389:Krt40 UTSW 11 99541714 nonsense probably null
R1104:Krt40 UTSW 11 99540233 missense probably damaging 1.00
R2018:Krt40 UTSW 11 99540087 missense probably damaging 1.00
R2022:Krt40 UTSW 11 99539992 missense probably damaging 1.00
R4498:Krt40 UTSW 11 99543074 missense possibly damaging 0.53
R4716:Krt40 UTSW 11 99540219 missense probably damaging 1.00
R5886:Krt40 UTSW 11 99540081 missense probably benign 0.34
R6232:Krt40 UTSW 11 99543094 missense possibly damaging 0.85
R6233:Krt40 UTSW 11 99543094 missense possibly damaging 0.85
R6235:Krt40 UTSW 11 99543094 missense possibly damaging 0.85
R6248:Krt40 UTSW 11 99541740 missense possibly damaging 0.95
R7064:Krt40 UTSW 11 99540128 missense probably benign 0.32
R7400:Krt40 UTSW 11 99543143 missense probably benign 0.00
R7589:Krt40 UTSW 11 99540157 missense probably damaging 1.00
R7831:Krt40 UTSW 11 99541261 missense probably benign 0.06
R7838:Krt40 UTSW 11 99540135 missense possibly damaging 0.92
Predicted Primers PCR Primer
(F):5'- TGCCTCAATTTCCCTTGCATTCCAAA -3'
(R):5'- CATCACTTACAAAGGAAACGTAGAGCCA -3'

Sequencing Primer
(F):5'- CCTTGCATTCCAAATGATGGTG -3'
(R):5'- cacacacactcacacacac -3'
Posted On2013-04-16