Mutagenetix > Incidental Mutations

Incidental Mutation 'R2186:Lrba'

237749

Institutional Source

Beutler Lab

Gene Symbol

Lrba

Ensembl Gene

ENSMUSG00000028080

Gene Name

LPS-responsive beige-like anchor

Synonyms

Lba, D3Ertd775e

MMRRC Submission

040188-MU

Accession Numbers

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R2186 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

86224680-86782692 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 86304336 bp

Zygosity

Heterozygous

Amino Acid Change

Tyrosine to Cysteine at position 421 (Y421C)

Ref Sequence

ENSEMBL: ENSMUSP00000148618 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000107635] [ENSMUST00000192145] [ENSMUST00000194759] [ENSMUST00000212390]

Predicted Effect

probably damaging
Transcript: ENSMUST00000107635
AA Change: Y421C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000103261
Gene: ENSMUSG00000028080
AA Change: Y421C

Domain	Start	End	E-Value	Type
low complexity region	12	31	N/A	INTRINSIC
Pfam:Laminin_G_3	211	377	4.6e-13	PFAM
Pfam:DUF4704	446	717	2.5e-109	PFAM
coiled coil region	1019	1037	N/A	INTRINSIC
low complexity region	1073	1089	N/A	INTRINSIC
low complexity region	1100	1113	N/A	INTRINSIC
low complexity region	1585	1600	N/A	INTRINSIC
low complexity region	1614	1630	N/A	INTRINSIC
low complexity region	1698	1713	N/A	INTRINSIC
low complexity region	1738	1757	N/A	INTRINSIC
low complexity region	1848	1861	N/A	INTRINSIC
Pfam:DUF1088	1882	2049	7e-88	PFAM
Pfam:PH_BEACH	2075	2172	9.1e-31	PFAM
Beach	2203	2480	2.87e-207	SMART
WD40	2578	2615	7.4e0	SMART
WD40	2618	2661	1.72e0	SMART
WD40	2677	2716	3.99e-1	SMART
WD40	2760	2798	1.79e-1	SMART
WD40	2801	2840	4.28e0	SMART

Predicted Effect

probably damaging
Transcript: ENSMUST00000192145
AA Change: Y421C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000142179
Gene: ENSMUSG00000028080
AA Change: Y421C

Domain	Start	End	E-Value	Type
low complexity region	12	31	N/A	INTRINSIC
Pfam:Laminin_G_3	205	377	7.4e-18	PFAM
coiled coil region	1019	1037	N/A	INTRINSIC
low complexity region	1073	1089	N/A	INTRINSIC
low complexity region	1100	1113	N/A	INTRINSIC
low complexity region	1585	1600	N/A	INTRINSIC
low complexity region	1614	1630	N/A	INTRINSIC
low complexity region	1698	1713	N/A	INTRINSIC
low complexity region	1738	1757	N/A	INTRINSIC
low complexity region	1848	1861	N/A	INTRINSIC
Pfam:DUF1088	1882	2050	1.5e-92	PFAM
Pfam:PH_BEACH	2068	2172	7.5e-32	PFAM
Beach	2203	2480	2.87e-207	SMART

Predicted Effect

probably damaging
Transcript: ENSMUST00000194759
AA Change: Y421C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000142043
Gene: ENSMUSG00000028080
AA Change: Y421C

Domain	Start	End	E-Value	Type
low complexity region	12	31	N/A	INTRINSIC
Pfam:Laminin_G_3	205	377	8.1e-18	PFAM
coiled coil region	1019	1037	N/A	INTRINSIC
low complexity region	1073	1089	N/A	INTRINSIC
low complexity region	1100	1113	N/A	INTRINSIC
low complexity region	1585	1600	N/A	INTRINSIC
low complexity region	1614	1630	N/A	INTRINSIC
low complexity region	1698	1713	N/A	INTRINSIC
low complexity region	1738	1757	N/A	INTRINSIC
low complexity region	1848	1861	N/A	INTRINSIC
Pfam:DUF1088	1882	2050	1.6e-92	PFAM
Pfam:PH_BEACH	2068	2172	8.3e-32	PFAM
Beach	2203	2480	2.87e-207	SMART
WD40	2578	2615	7.4e0	SMART
WD40	2618	2661	1.72e0	SMART
WD40	2677	2716	3.99e-1	SMART

Predicted Effect

probably damaging
Transcript: ENSMUST00000212390
AA Change: Y421C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

Meta Mutation Damage Score

0.9541

Coding Region Coverage

1x: 99.2%
3x: 98.6%
10x: 97.4%
20x: 95.4%

Validation Efficiency

100% (51/51)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the WDL-BEACH-WD (WBW) gene family. Its expression is induced in B cells and macrophages by bacterial lipopolysaccharides (LPS). The encoded protein associates with protein kinase A and may be involved in leading intracellular vesicles to activated receptor complexes, which aids in the secretion and/or membrane deposition of immune effector molecules. Defects in this gene are associated with the disorder common variable immunodeficiency-8 with autoimmunity. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Dec 2012]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit increased numbers of myeloid-derived suppressor cells and regulatory T cells, abnormal NK cell physiology, impaired rejection of allogeneic, xenogeneic and missing self bone-marrow grafts, and resistance to acute graft vs host disease. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 46 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2310033P09Rik	A	G	11: 59,208,514	N29S	probably damaging	Het
4931409K22Rik	C	T	5: 24,554,526	G82E	probably damaging	Het
Ap1b1	T	C	11: 5,015,737	V92A	possibly damaging	Het
Asgr1	G	A	11: 70,056,249	R66Q	probably benign	Het
Atp8b4	T	A	2: 126,358,860	Q796L	probably damaging	Het
Camk4	A	C	18: 33,182,341	D307A	probably damaging	Het
Catsperb	T	A	12: 101,480,782	I223K	probably benign	Het
Ccdc80	A	G	16: 45,118,105	Y725C	probably damaging	Het
Cep164	T	A	9: 45,768,578	Q1119L	probably damaging	Het
Cep85l	G	A	10: 53,348,618	P292S	probably damaging	Het
Cfap53	A	G	18: 74,329,505		probably null	Het
Cts8	C	A	13: 61,251,731	C138F	probably damaging	Het
Dis3l	C	A	9: 64,339,612	E54*	probably null	Het
Dnaja1	T	A	4: 40,732,853	D367E	probably benign	Het
Duoxa2	T	C	2: 122,299,174	I45T	probably damaging	Het
EU599041	C	T	7: 43,225,909		noncoding transcript	Het
Exoc5	T	C	14: 49,015,479	M561V	probably benign	Het
Fam184a	T	C	10: 53,638,194	I296V	probably damaging	Het
Fbxl18	C	T	5: 142,878,761	V686M	probably damaging	Het
Fryl	A	G	5: 73,064,975	S2088P	probably damaging	Het
Fus	G	A	7: 127,985,534		probably benign	Het
Gm38394	A	G	1: 133,658,079	S507P	probably damaging	Het
Gpr183	T	A	14: 121,954,315	I265L	probably benign	Het
Herc1	T	G	9: 66,439,901	L2013V	probably benign	Het
Ick	C	T	9: 78,131,487	T6M	probably benign	Het
Iqca	T	C	1: 90,081,344	K430R	probably benign	Het
Itpripl2	A	G	7: 118,491,277	C20R	probably damaging	Het
Kmt2c	C	A	5: 25,287,112	C852F	probably damaging	Het
Lamb1	A	T	12: 31,318,467	K1199*	probably null	Het
Lrig2	A	G	3: 104,468,598	L96P	probably benign	Het
Mcc	A	G	18: 44,812,078	F29S	possibly damaging	Het
Mlh1	T	C	9: 111,258,566		probably benign	Het
Mpp5	T	C	12: 78,819,371		probably benign	Het
Rbm33	A	G	5: 28,394,230	T867A	unknown	Het
Sdk1	T	A	5: 142,046,292	S1041T	probably benign	Het
Serpinb2	A	G	1: 107,523,964		probably null	Het
Serpinb9d	A	G	13: 33,203,047	N366S	possibly damaging	Het
Sf3b1	A	G	1: 55,007,633	S251P	probably benign	Het
Slc45a1	T	C	4: 150,638,251	Y392C	probably benign	Het
Tlr4	T	A	4: 66,839,983	C338S	possibly damaging	Het
Trio	A	G	15: 27,823,975		probably null	Het
Vnn1	A	T	10: 23,897,401	I109L	probably benign	Het
Wnk1	A	G	6: 119,948,567	V1312A	probably benign	Het
Zfp28	A	G	7: 6,394,498	H644R	probably damaging	Het
Zfp286	A	G	11: 62,780,461	V262A	probably damaging	Het
Zfp292	A	T	4: 34,807,962	M1694K	probably benign	Het

Other mutations in Lrba

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00420:Lrba	APN	3	86359782	missense	probably benign	0.00
IGL00788:Lrba	APN	3	86327685	missense	probably damaging	0.97
IGL01139:Lrba	APN	3	86642662	missense	possibly damaging	0.88
IGL01302:Lrba	APN	3	86295400	missense	probably damaging	1.00
IGL01612:Lrba	APN	3	86776177	missense	possibly damaging	0.89
IGL01718:Lrba	APN	3	86351248	missense	probably damaging	1.00
IGL01719:Lrba	APN	3	86327596	splice site	probably benign
IGL01730:Lrba	APN	3	86741424	missense	possibly damaging	0.89
IGL01735:Lrba	APN	3	86327661	missense	probably benign	0.28
IGL01875:Lrba	APN	3	86310047	missense	probably damaging	1.00
IGL01884:Lrba	APN	3	86310412	missense	possibly damaging	0.86
IGL02264:Lrba	APN	3	86780262	missense	probably damaging	0.99
IGL02638:Lrba	APN	3	86325073	missense	probably damaging	0.97
IGL02647:Lrba	APN	3	86359731	missense	probably benign	0.00
IGL02664:Lrba	APN	3	86325731	missense	possibly damaging	0.84
IGL02728:Lrba	APN	3	86776049	missense	probably damaging	0.99
IGL02730:Lrba	APN	3	86328199	missense	probably damaging	1.00
IGL02883:Lrba	APN	3	86354206	missense	probably damaging	1.00
IGL02883:Lrba	APN	3	86445413	missense	probably damaging	0.99
IGL02948:Lrba	APN	3	86310384	splice site	probably null
IGL03090:Lrba	APN	3	86773141	missense	probably benign	0.01
molasses	UTSW	3	86354307	critical splice donor site	probably null
oscar	UTSW	3	86350304	nonsense	probably null
oscar2	UTSW	3	86664458	nonsense	probably null
P0023:Lrba	UTSW	3	86417935	missense	probably damaging	1.00
PIT4802001:Lrba	UTSW	3	86664494	nonsense	probably null
R0077:Lrba	UTSW	3	86542688	missense	probably damaging	0.99
R0189:Lrba	UTSW	3	86368509	missense	probably damaging	1.00
R0217:Lrba	UTSW	3	86642722	missense	probably damaging	1.00
R0349:Lrba	UTSW	3	86540005	missense	probably damaging	1.00
R0396:Lrba	UTSW	3	86295179	missense	probably damaging	1.00
R0417:Lrba	UTSW	3	86715654	missense	probably damaging	1.00
R0536:Lrba	UTSW	3	86715532	missense	probably damaging	1.00
R0712:Lrba	UTSW	3	86297990	nonsense	probably null
R0722:Lrba	UTSW	3	86605989	critical splice donor site	probably null
R0828:Lrba	UTSW	3	86608370	synonymous	probably null
R0927:Lrba	UTSW	3	86780233	missense	probably damaging	1.00
R1120:Lrba	UTSW	3	86295192	missense	probably damaging	1.00
R1141:Lrba	UTSW	3	86619558	missense	probably damaging	1.00
R1276:Lrba	UTSW	3	86664526	missense	probably damaging	1.00
R1449:Lrba	UTSW	3	86354278	missense	probably damaging	1.00
R1470:Lrba	UTSW	3	86737142	missense	probably damaging	1.00
R1470:Lrba	UTSW	3	86737142	missense	probably damaging	1.00
R1474:Lrba	UTSW	3	86780266	splice site	probably benign
R1558:Lrba	UTSW	3	86351315	missense	probably damaging	1.00
R1596:Lrba	UTSW	3	86350304	nonsense	probably null
R1652:Lrba	UTSW	3	86539938	missense	probably damaging	1.00
R1800:Lrba	UTSW	3	86351868	missense	probably benign	0.00
R1819:Lrba	UTSW	3	86542634	missense	possibly damaging	0.80
R1862:Lrba	UTSW	3	86773203	critical splice donor site	probably null
R1917:Lrba	UTSW	3	86664501	missense	probably damaging	1.00
R1965:Lrba	UTSW	3	86605868	critical splice acceptor site	probably null
R1966:Lrba	UTSW	3	86605868	critical splice acceptor site	probably null
R1969:Lrba	UTSW	3	86608389	missense	probably damaging	0.99
R2011:Lrba	UTSW	3	86310017	missense	probably damaging	0.99
R2179:Lrba	UTSW	3	86354281	missense	probably damaging	1.00
R2281:Lrba	UTSW	3	86776103	missense	possibly damaging	0.46
R2359:Lrba	UTSW	3	86348750	missense	probably benign	0.01
R2412:Lrba	UTSW	3	86327700	missense	probably damaging	1.00
R2496:Lrba	UTSW	3	86532087	missense	probably damaging	1.00
R3153:Lrba	UTSW	3	86285219	missense	probably damaging	0.99
R3708:Lrba	UTSW	3	86285024	missense	possibly damaging	0.80
R3746:Lrba	UTSW	3	86375953	missense	probably damaging	1.00
R3747:Lrba	UTSW	3	86375953	missense	probably damaging	1.00
R3748:Lrba	UTSW	3	86375953	missense	probably damaging	1.00
R3749:Lrba	UTSW	3	86375953	missense	probably damaging	1.00
R3750:Lrba	UTSW	3	86375953	missense	probably damaging	1.00
R3758:Lrba	UTSW	3	86776049	missense	probably damaging	0.99
R3975:Lrba	UTSW	3	86351255	missense	probably damaging	1.00
R4210:Lrba	UTSW	3	86360126	missense	probably damaging	1.00
R4258:Lrba	UTSW	3	86445349	missense	probably damaging	1.00
R4657:Lrba	UTSW	3	86737164	missense	probably damaging	1.00
R4713:Lrba	UTSW	3	86359868	missense	probably benign	0.13
R4716:Lrba	UTSW	3	86642714	missense	probably damaging	0.99
R4811:Lrba	UTSW	3	86776141	missense	probably damaging	1.00
R4827:Lrba	UTSW	3	86360150	missense	possibly damaging	0.85
R4840:Lrba	UTSW	3	86619509	critical splice acceptor site	probably null
R4920:Lrba	UTSW	3	86664458	nonsense	probably null
R4948:Lrba	UTSW	3	86285028	missense	probably damaging	1.00
R4970:Lrba	UTSW	3	86225371	missense	probably benign	0.23
R4985:Lrba	UTSW	3	86327436	intron	probably null
R4993:Lrba	UTSW	3	86360037	missense	probably damaging	1.00
R5107:Lrba	UTSW	3	86359779	missense	possibly damaging	0.47
R5112:Lrba	UTSW	3	86225371	missense	probably benign	0.23
R5122:Lrba	UTSW	3	86349154	nonsense	probably null
R5155:Lrba	UTSW	3	86351300	missense	probably benign	0.25
R5194:Lrba	UTSW	3	86328219	missense	probably damaging	1.00
R5280:Lrba	UTSW	3	86325022	missense	possibly damaging	0.94
R5445:Lrba	UTSW	3	86368595	missense	probably benign
R5469:Lrba	UTSW	3	86542641	missense	probably damaging	1.00
R5513:Lrba	UTSW	3	86542641	missense	probably damaging	1.00
R5578:Lrba	UTSW	3	86757507	missense	probably benign	0.27
R5740:Lrba	UTSW	3	86328342	missense	probably damaging	1.00
R5868:Lrba	UTSW	3	86319604	missense	probably damaging	1.00
R6104:Lrba	UTSW	3	86353792	missense	probably damaging	1.00
R6166:Lrba	UTSW	3	86354307	critical splice donor site	probably null
R6279:Lrba	UTSW	3	86348864	missense	probably benign	0.26
R6330:Lrba	UTSW	3	86348357	missense	probably benign	0.07
R6367:Lrba	UTSW	3	86368562	missense	probably benign	0.42
R6571:Lrba	UTSW	3	86360060	missense	probably damaging	1.00
R6584:Lrba	UTSW	3	86664576	missense	probably damaging	1.00
R6698:Lrba	UTSW	3	86304425	missense	probably damaging	0.99
R6763:Lrba	UTSW	3	86354263	missense	probably damaging	1.00
R6834:Lrba	UTSW	3	86350286	missense	probably benign	0.00
R6951:Lrba	UTSW	3	86745873	missense	probably benign	0.01
R6969:Lrba	UTSW	3	86619590	missense	probably benign	0.21
R7045:Lrba	UTSW	3	86285091	missense	probably benign	0.03
R7133:Lrba	UTSW	3	86394931	intron	probably null
R7182:Lrba	UTSW	3	86741458	frame shift	probably null
R7214:Lrba	UTSW	3	86328326	missense	probably damaging	1.00
R7224:Lrba	UTSW	3	86395246	missense	probably damaging	1.00
R7243:Lrba	UTSW	3	86751516	splice site	probably null
R7350:Lrba	UTSW	3	86351902	missense	probably damaging	0.96
R7380:Lrba	UTSW	3	86325074	missense	probably damaging	1.00
R7492:Lrba	UTSW	3	86664528	missense	probably damaging	1.00
R7651:Lrba	UTSW	3	86741466	nonsense	probably null
R7729:Lrba	UTSW	3	86318167	missense	probably damaging	1.00
R7754:Lrba	UTSW	3	86445397	missense	probably damaging	1.00
R7762:Lrba	UTSW	3	86532201	missense	probably damaging	0.99
R7855:Lrba	UTSW	3	86315430	missense	possibly damaging	0.94
R7867:Lrba	UTSW	3	86368589	missense	probably damaging	1.00
R7912:Lrba	UTSW	3	86715565	missense	probably damaging	1.00
R7938:Lrba	UTSW	3	86315430	missense	possibly damaging	0.94
R7950:Lrba	UTSW	3	86368589	missense	probably damaging	1.00
R7993:Lrba	UTSW	3	86715565	missense	probably damaging	1.00
R7995:Lrba	UTSW	3	86619551	missense	probably damaging	1.00
R8013:Lrba	UTSW	3	86417971	missense	probably damaging	1.00
R8014:Lrba	UTSW	3	86417971	missense	probably damaging	1.00
R8024:Lrba	UTSW	3	86295401	nonsense	probably null
R8027:Lrba	UTSW	3	86417912	missense	probably benign	0.05
X0065:Lrba	UTSW	3	86297899	missense	probably damaging	1.00
X0065:Lrba	UTSW	3	86325089	missense	possibly damaging	0.95
Z1176:Lrba	UTSW	3	86715538	missense	probably benign	0.31
Z1176:Lrba	UTSW	3	86751532	missense	possibly damaging	0.85
Z1177:Lrba	UTSW	3	86540049	missense	probably null	1.00

Predicted Primers

PCR Primer
(F):5'- TCGGATGTCTTACCTGGTAGCG -3'
(R):5'- ATACAGGAACACTACGATGTGGC -3'

Sequencing Primer
(F):5'- CTTACCTGGTAGCGTTACATTTTATG -3'
(R):5'- TGGCACGCCGCATATTTAAG -3'

Posted On

2014-10-02