Mutagenetix > Incidental Mutations

Incidental Mutation 'R2186:Tlr4'

237753

Institutional Source

Beutler Lab

Gene Symbol

Tlr4

Ensembl Gene

ENSMUSG00000039005

Gene Name

toll-like receptor 4

Synonyms

Rasl2-8, Lps, lipopolysaccharide response

MMRRC Submission

040188-MU

Accession Numbers

MGI: 96824

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R2186 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

66827584-66930284 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 66839983 bp

Zygosity

Heterozygous

Amino Acid Change

Cysteine to Serine at position 338 (C338S)

Ref Sequence

ENSEMBL: ENSMUSP00000045770 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000048096] [ENSMUST00000107365]

PDB Structure

Crystal structure of mouse TLR4 and mouse MD-2 complex [X-RAY DIFFRACTION]
Crystal structure of mouse TLR4/MD-2/lipid IVa complex [X-RAY DIFFRACTION]
Crystal structure of mouse TLR4/MD-2/LPS complex [X-RAY DIFFRACTION]

Predicted Effect

possibly damaging
Transcript: ENSMUST00000048096
AA Change: C338S

PolyPhen 2 Score 0.625 (Sensitivity: 0.87; Specificity: 0.91)

SMART Domains

Protein: ENSMUSP00000045770
Gene: ENSMUSG00000039005
AA Change: C338S

Domain	Start	End	E-Value	Type
LRR	76	99	7.36e0	SMART
LRR	100	123	1.86e0	SMART
LRR	173	196	8.24e0	SMART
LRR	370	401	4.33e1	SMART
LRR	468	492	2.54e2	SMART
LRR	493	516	1.86e2	SMART
LRR	517	540	1.67e2	SMART
LRR	541	563	1.92e2	SMART
LRRCT	576	626	4.74e-3	SMART
transmembrane domain	636	658	N/A	INTRINSIC
TIR	671	816	7.3e-39	SMART
low complexity region	822	833	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000107365

SMART Domains

Protein: ENSMUSP00000102988
Gene: ENSMUSG00000039005

Domain	Start	End	E-Value	Type
PDB:3VQ2\|B	22	86	2e-38	PDB
SCOP:d1m0za_	27	86	4e-6	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000143580

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000147008

Meta Mutation Damage Score

0.1721

Coding Region Coverage

1x: 99.2%
3x: 98.6%
10x: 97.4%
20x: 95.4%

Validation Efficiency

100% (51/51)

MGI Phenotype

FUNCTION: This gene belongs to the evolutionarily-conserved Toll-like receptor family, whose members are type-1 transmembrane proteins that are involved in innate immunity. Toll-like receptors are characterized by an extracellular leucine-rich repeat domain that functions in ligand recognition and an intracellular toll/interleukin-1 receptor-like domain that is crucial for signal transduction. The receptor encoded by this gene mediates the innate immune response to bacterial lipopolysaccharide, a major component of the outer membrane of Gram-negative bacteria, through synthesis of pro-inflammatory cytokines and chemokines. In addition, this protein can recognize other pathogens from Gram-negative and Gram-positive bacteria as well as viral components. Mice deficient in this gene display a number of immune response-related phenotypes including hyporesponsiveness to bacterial lipopolysaccharide and increased levels of respiratory syncytial virus compared to controls. [provided by RefSeq, Sep 2015]
PHENOTYPE: Homozygotes for spontaneous or targeted mutations are hyporesponsive to bacterial lipopolysaccharide and more susceptible to infection by gram negative bacteria. [provided by MGI curators]

Allele List at MGI

All alleles(10) : Targeted(2) Spontaneous(6) Chemically induced(2)

Other mutations in this stock

Total: 46 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2310033P09Rik	A	G	11: 59,208,514	N29S	probably damaging	Het
4931409K22Rik	C	T	5: 24,554,526	G82E	probably damaging	Het
Ap1b1	T	C	11: 5,015,737	V92A	possibly damaging	Het
Asgr1	G	A	11: 70,056,249	R66Q	probably benign	Het
Atp8b4	T	A	2: 126,358,860	Q796L	probably damaging	Het
Camk4	A	C	18: 33,182,341	D307A	probably damaging	Het
Catsperb	T	A	12: 101,480,782	I223K	probably benign	Het
Ccdc80	A	G	16: 45,118,105	Y725C	probably damaging	Het
Cep164	T	A	9: 45,768,578	Q1119L	probably damaging	Het
Cep85l	G	A	10: 53,348,618	P292S	probably damaging	Het
Cfap53	A	G	18: 74,329,505		probably null	Het
Cts8	C	A	13: 61,251,731	C138F	probably damaging	Het
Dis3l	C	A	9: 64,339,612	E54*	probably null	Het
Dnaja1	T	A	4: 40,732,853	D367E	probably benign	Het
Duoxa2	T	C	2: 122,299,174	I45T	probably damaging	Het
EU599041	C	T	7: 43,225,909		noncoding transcript	Het
Exoc5	T	C	14: 49,015,479	M561V	probably benign	Het
Fam184a	T	C	10: 53,638,194	I296V	probably damaging	Het
Fbxl18	C	T	5: 142,878,761	V686M	probably damaging	Het
Fryl	A	G	5: 73,064,975	S2088P	probably damaging	Het
Fus	G	A	7: 127,985,534		probably benign	Het
Gm38394	A	G	1: 133,658,079	S507P	probably damaging	Het
Gpr183	T	A	14: 121,954,315	I265L	probably benign	Het
Herc1	T	G	9: 66,439,901	L2013V	probably benign	Het
Ick	C	T	9: 78,131,487	T6M	probably benign	Het
Iqca	T	C	1: 90,081,344	K430R	probably benign	Het
Itpripl2	A	G	7: 118,491,277	C20R	probably damaging	Het
Kmt2c	C	A	5: 25,287,112	C852F	probably damaging	Het
Lamb1	A	T	12: 31,318,467	K1199*	probably null	Het
Lrba	A	G	3: 86,304,336	Y421C	probably damaging	Het
Lrig2	A	G	3: 104,468,598	L96P	probably benign	Het
Mcc	A	G	18: 44,812,078	F29S	possibly damaging	Het
Mlh1	T	C	9: 111,258,566		probably benign	Het
Mpp5	T	C	12: 78,819,371		probably benign	Het
Rbm33	A	G	5: 28,394,230	T867A	unknown	Het
Sdk1	T	A	5: 142,046,292	S1041T	probably benign	Het
Serpinb2	A	G	1: 107,523,964		probably null	Het
Serpinb9d	A	G	13: 33,203,047	N366S	possibly damaging	Het
Sf3b1	A	G	1: 55,007,633	S251P	probably benign	Het
Slc45a1	T	C	4: 150,638,251	Y392C	probably benign	Het
Trio	A	G	15: 27,823,975		probably null	Het
Vnn1	A	T	10: 23,897,401	I109L	probably benign	Het
Wnk1	A	G	6: 119,948,567	V1312A	probably benign	Het
Zfp28	A	G	7: 6,394,498	H644R	probably damaging	Het
Zfp286	A	G	11: 62,780,461	V262A	probably damaging	Het
Zfp292	A	T	4: 34,807,962	M1694K	probably benign	Het

Other mutations in Tlr4

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01120:Tlr4	APN	4	66840425	missense	probably benign	0.01
IGL01343:Tlr4	APN	4	66833887	splice site	probably benign
IGL01669:Tlr4	APN	4	66841267	missense	possibly damaging	0.48
IGL01875:Tlr4	APN	4	66839489	missense	probably damaging	1.00
IGL02138:Tlr4	APN	4	66840965	missense	probably damaging	0.99
IGL02244:Tlr4	APN	4	66834061	critical splice donor site	probably null
IGL02793:Tlr4	APN	4	66839444	missense	probably damaging	1.00
IGL03269:Tlr4	APN	4	66840796	missense	probably damaging	1.00
IGL03288:Tlr4	APN	4	66839753	missense	probably damaging	0.99
bugsy	UTSW	4	66839254	nonsense	probably null
Cruyff	UTSW	4	66840326	missense	probably damaging	1.00
don_knotts	UTSW	4	66841172	missense	probably damaging	1.00
Guardiola	UTSW	4	66839303	missense	probably damaging	1.00
Lops	UTSW	4	66833880	splice site	probably null
lps3	UTSW	4	66841097	missense	probably damaging	1.00
Lps4	UTSW	4	66841142	missense	probably damaging	1.00
milquetoast	UTSW	4	66839444	missense	probably damaging	1.00
salvador	UTSW	4	66840206	missense	probably damaging	0.99
R0449:Tlr4	UTSW	4	66839620	missense	probably damaging	0.99
R0481:Tlr4	UTSW	4	66827916	missense	probably benign	0.05
R0576:Tlr4	UTSW	4	66839495	missense	probably benign	0.00
R0827:Tlr4	UTSW	4	66833880	splice site	probably null
R1488:Tlr4	UTSW	4	66839549	missense	probably damaging	1.00
R1490:Tlr4	UTSW	4	66839374	missense	possibly damaging	0.56
R1522:Tlr4	UTSW	4	66839696	missense	possibly damaging	0.80
R1616:Tlr4	UTSW	4	66839480	missense	probably damaging	1.00
R1681:Tlr4	UTSW	4	66841105	missense	probably damaging	1.00
R1738:Tlr4	UTSW	4	66841076	missense	probably benign	0.19
R1888:Tlr4	UTSW	4	66841172	missense	probably damaging	1.00
R1888:Tlr4	UTSW	4	66841172	missense	probably damaging	1.00
R1929:Tlr4	UTSW	4	66839444	missense	probably damaging	1.00
R1982:Tlr4	UTSW	4	66841035	missense	probably benign	0.40
R1998:Tlr4	UTSW	4	66840470	missense	probably damaging	1.00
R2305:Tlr4	UTSW	4	66840101	missense	probably damaging	1.00
R3011:Tlr4	UTSW	4	66839254	nonsense	probably null
R3420:Tlr4	UTSW	4	66839536	missense	probably benign	0.37
R3422:Tlr4	UTSW	4	66839536	missense	probably benign	0.37
R3818:Tlr4	UTSW	4	66841316	missense	probably benign	0.00
R4212:Tlr4	UTSW	4	66840326	missense	probably damaging	1.00
R4213:Tlr4	UTSW	4	66840326	missense	probably damaging	1.00
R4417:Tlr4	UTSW	4	66839303	missense	probably damaging	1.00
R4630:Tlr4	UTSW	4	66839240	missense	probably benign	0.44
R4735:Tlr4	UTSW	4	66841198	missense	probably damaging	1.00
R5191:Tlr4	UTSW	4	66841379	missense	probably damaging	0.96
R5613:Tlr4	UTSW	4	66840885	missense	possibly damaging	0.94
R5705:Tlr4	UTSW	4	66833980	missense	probably damaging	1.00
R5726:Tlr4	UTSW	4	66840415	missense	probably benign
R6021:Tlr4	UTSW	4	66840866	missense	probably damaging	1.00
R6159:Tlr4	UTSW	4	66839833	missense	possibly damaging	0.92
R6227:Tlr4	UTSW	4	66840595	missense	probably benign
R7139:Tlr4	UTSW	4	66840283	missense	probably benign	0.06
R7199:Tlr4	UTSW	4	66841193	missense	probably damaging	0.99
R7220:Tlr4	UTSW	4	66839951	missense	probably benign
R7337:Tlr4	UTSW	4	66839954	missense	possibly damaging	0.86
R7487:Tlr4	UTSW	4	66924422	missense	probably benign	0.00
R7638:Tlr4	UTSW	4	66840206	missense	probably damaging	0.99
R7773:Tlr4	UTSW	4	66839599	missense	probably damaging	1.00
R7814:Tlr4	UTSW	4	66841079	missense	probably damaging	1.00
R7897:Tlr4	UTSW	4	66839821	missense	probably benign	0.07
R8044:Tlr4	UTSW	4	66827847	missense	probably benign	0.01
R8062:Tlr4	UTSW	4	66839850	missense	probably benign	0.00
R8080:Tlr4	UTSW	4	66839476	missense	probably damaging	1.00
R8446:Tlr4	UTSW	4	66839436	missense	probably damaging	0.98
X0064:Tlr4	UTSW	4	66840140	missense	probably damaging	0.99
Z1088:Tlr4	UTSW	4	66929082	missense	probably benign	0.01

Predicted Primers

PCR Primer
(F):5'- AAGGACTATGTGATGTGACCATTG -3'
(R):5'- ATGGCACCATTGAAGCTGAG -3'

Sequencing Primer
(F):5'- GTGACCATTGATGAGTTCAGGTTAAC -3'
(R):5'- ACCATTGAAGCTGAGGTCTAAGTGTC -3'

Posted On

2014-10-02