Incidental Mutation 'R2186:4931409K22Rik'
ID237755
Institutional Source Beutler Lab
Gene Symbol 4931409K22Rik
Ensembl Gene ENSMUSG00000038199
Gene NameRIKEN cDNA 4931409K22 gene
Synonyms
MMRRC Submission 040188-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.114) question?
Stock #R2186 (G1)
Quality Score225
Status Validated
Chromosome5
Chromosomal Location24543432-24556809 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 24554526 bp
ZygosityHeterozygous
Amino Acid Change Glycine to Glutamic Acid at position 82 (G82E)
Ref Sequence ENSEMBL: ENSMUSP00000142624 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000088302] [ENSMUST00000198887] [ENSMUST00000200634]
Predicted Effect probably damaging
Transcript: ENSMUST00000088302
AA Change: G82E

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000085642
Gene: ENSMUSG00000038199
AA Change: G82E

DomainStartEndE-ValueType
low complexity region 46 54 N/A INTRINSIC
low complexity region 70 77 N/A INTRINSIC
low complexity region 184 198 N/A INTRINSIC
IQ 205 227 7.58e-2 SMART
coiled coil region 335 382 N/A INTRINSIC
coiled coil region 429 450 N/A INTRINSIC
low complexity region 467 484 N/A INTRINSIC
Pfam:AAA 568 700 1.6e-14 PFAM
low complexity region 819 825 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000198709
Predicted Effect probably damaging
Transcript: ENSMUST00000198887
AA Change: G82E

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000142918
Gene: ENSMUSG00000038199
AA Change: G82E

DomainStartEndE-ValueType
low complexity region 46 54 N/A INTRINSIC
low complexity region 70 77 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000199185
Predicted Effect probably damaging
Transcript: ENSMUST00000200634
AA Change: G82E

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000142624
Gene: ENSMUSG00000038199
AA Change: G82E

DomainStartEndE-ValueType
low complexity region 46 54 N/A INTRINSIC
low complexity region 70 77 N/A INTRINSIC
low complexity region 184 198 N/A INTRINSIC
Meta Mutation Damage Score 0.6467 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.4%
Validation Efficiency 100% (51/51)
Allele List at MGI
Other mutations in this stock
Total: 46 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310033P09Rik A G 11: 59,208,514 N29S probably damaging Het
Ap1b1 T C 11: 5,015,737 V92A possibly damaging Het
Asgr1 G A 11: 70,056,249 R66Q probably benign Het
Atp8b4 T A 2: 126,358,860 Q796L probably damaging Het
Camk4 A C 18: 33,182,341 D307A probably damaging Het
Catsperb T A 12: 101,480,782 I223K probably benign Het
Ccdc80 A G 16: 45,118,105 Y725C probably damaging Het
Cep164 T A 9: 45,768,578 Q1119L probably damaging Het
Cep85l G A 10: 53,348,618 P292S probably damaging Het
Cfap53 A G 18: 74,329,505 probably null Het
Cts8 C A 13: 61,251,731 C138F probably damaging Het
Dis3l C A 9: 64,339,612 E54* probably null Het
Dnaja1 T A 4: 40,732,853 D367E probably benign Het
Duoxa2 T C 2: 122,299,174 I45T probably damaging Het
EU599041 C T 7: 43,225,909 noncoding transcript Het
Exoc5 T C 14: 49,015,479 M561V probably benign Het
Fam184a T C 10: 53,638,194 I296V probably damaging Het
Fbxl18 C T 5: 142,878,761 V686M probably damaging Het
Fryl A G 5: 73,064,975 S2088P probably damaging Het
Fus G A 7: 127,985,534 probably benign Het
Gm38394 A G 1: 133,658,079 S507P probably damaging Het
Gpr183 T A 14: 121,954,315 I265L probably benign Het
Herc1 T G 9: 66,439,901 L2013V probably benign Het
Ick C T 9: 78,131,487 T6M probably benign Het
Iqca T C 1: 90,081,344 K430R probably benign Het
Itpripl2 A G 7: 118,491,277 C20R probably damaging Het
Kmt2c C A 5: 25,287,112 C852F probably damaging Het
Lamb1 A T 12: 31,318,467 K1199* probably null Het
Lrba A G 3: 86,304,336 Y421C probably damaging Het
Lrig2 A G 3: 104,468,598 L96P probably benign Het
Mcc A G 18: 44,812,078 F29S possibly damaging Het
Mlh1 T C 9: 111,258,566 probably benign Het
Mpp5 T C 12: 78,819,371 probably benign Het
Rbm33 A G 5: 28,394,230 T867A unknown Het
Sdk1 T A 5: 142,046,292 S1041T probably benign Het
Serpinb2 A G 1: 107,523,964 probably null Het
Serpinb9d A G 13: 33,203,047 N366S possibly damaging Het
Sf3b1 A G 1: 55,007,633 S251P probably benign Het
Slc45a1 T C 4: 150,638,251 Y392C probably benign Het
Tlr4 T A 4: 66,839,983 C338S possibly damaging Het
Trio A G 15: 27,823,975 probably null Het
Vnn1 A T 10: 23,897,401 I109L probably benign Het
Wnk1 A G 6: 119,948,567 V1312A probably benign Het
Zfp28 A G 7: 6,394,498 H644R probably damaging Het
Zfp286 A G 11: 62,780,461 V262A probably damaging Het
Zfp292 A T 4: 34,807,962 M1694K probably benign Het
Other mutations in 4931409K22Rik
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01383:4931409K22Rik APN 5 24548294 missense probably benign 0.03
IGL02110:4931409K22Rik APN 5 24548084 splice site probably benign
R0329:4931409K22Rik UTSW 5 24545785 unclassified probably null
R0492:4931409K22Rik UTSW 5 24554628 missense probably damaging 1.00
R0585:4931409K22Rik UTSW 5 24550723 missense probably benign
R0656:4931409K22Rik UTSW 5 24549762 missense possibly damaging 0.67
R0894:4931409K22Rik UTSW 5 24550733 unclassified probably null
R1546:4931409K22Rik UTSW 5 24555428 utr 5 prime probably null
R1642:4931409K22Rik UTSW 5 24552688 missense probably damaging 1.00
R1998:4931409K22Rik UTSW 5 24545006 missense probably benign 0.01
R2090:4931409K22Rik UTSW 5 24550676 missense probably benign 0.15
R2237:4931409K22Rik UTSW 5 24548294 missense probably benign 0.03
R2256:4931409K22Rik UTSW 5 24552040 utr 3 prime probably benign
R2257:4931409K22Rik UTSW 5 24552040 utr 3 prime probably benign
R3078:4931409K22Rik UTSW 5 24546666 missense probably benign
R3522:4931409K22Rik UTSW 5 24549626 critical splice donor site probably null
R3910:4931409K22Rik UTSW 5 24545442 splice site probably benign
R3911:4931409K22Rik UTSW 5 24545442 splice site probably benign
R4333:4931409K22Rik UTSW 5 24544370 missense probably damaging 1.00
R4335:4931409K22Rik UTSW 5 24544370 missense probably damaging 1.00
R4500:4931409K22Rik UTSW 5 24548277 missense possibly damaging 0.85
R4761:4931409K22Rik UTSW 5 24551983 missense probably benign
R4773:4931409K22Rik UTSW 5 24550598 critical splice donor site probably null
R4880:4931409K22Rik UTSW 5 24549752 missense probably benign
R5614:4931409K22Rik UTSW 5 24550142 missense probably benign 0.03
R5839:4931409K22Rik UTSW 5 24552026 missense probably damaging 0.98
R5847:4931409K22Rik UTSW 5 24544166 missense probably benign 0.16
R7061:4931409K22Rik UTSW 5 24545065 missense probably benign 0.00
R7131:4931409K22Rik UTSW 5 24548956 missense possibly damaging 0.81
R7156:4931409K22Rik UTSW 5 24552650 missense probably benign 0.05
R7248:4931409K22Rik UTSW 5 24544271 missense probably benign 0.00
R7480:4931409K22Rik UTSW 5 24546906 missense probably damaging 1.00
R7693:4931409K22Rik UTSW 5 24546628 missense probably benign 0.01
R7782:4931409K22Rik UTSW 5 24544226 missense probably damaging 0.98
R7814:4931409K22Rik UTSW 5 24545422 missense possibly damaging 0.95
X0063:4931409K22Rik UTSW 5 24549765 splice site probably null
Predicted Primers PCR Primer
(F):5'- AAAGCACCCCAGTTCCTGAG -3'
(R):5'- ATCTGTGCTCGAACCTGTGC -3'

Sequencing Primer
(F):5'- TCCTGAGAGTCTAAATTCCAAGTCC -3'
(R):5'- TCGAACCTGTGCCCAGC -3'
Posted On2014-10-02