Incidental Mutation 'R2186:Cep164'
ID237768
Institutional Source Beutler Lab
Gene Symbol Cep164
Ensembl Gene ENSMUSG00000043987
Gene Namecentrosomal protein 164
Synonyms
MMRRC Submission 040188-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R2186 (G1)
Quality Score225
Status Validated
Chromosome9
Chromosomal Location45766946-45828691 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 45768578 bp
ZygosityHeterozygous
Amino Acid Change Glutamine to Leucine at position 1119 (Q1119L)
Ref Sequence ENSEMBL: ENSMUSP00000150742 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000117194] [ENSMUST00000213154] [ENSMUST00000216284]
Predicted Effect possibly damaging
Transcript: ENSMUST00000117194
AA Change: Q1280L

PolyPhen 2 Score 0.462 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000114053
Gene: ENSMUSG00000043987
AA Change: Q1280L

DomainStartEndE-ValueType
WW 57 89 1.99e-3 SMART
low complexity region 110 127 N/A INTRINSIC
low complexity region 189 201 N/A INTRINSIC
low complexity region 210 229 N/A INTRINSIC
low complexity region 362 375 N/A INTRINSIC
coiled coil region 511 735 N/A INTRINSIC
low complexity region 741 756 N/A INTRINSIC
coiled coil region 761 931 N/A INTRINSIC
low complexity region 956 962 N/A INTRINSIC
coiled coil region 1057 1084 N/A INTRINSIC
low complexity region 1095 1110 N/A INTRINSIC
low complexity region 1141 1168 N/A INTRINSIC
low complexity region 1185 1195 N/A INTRINSIC
low complexity region 1235 1248 N/A INTRINSIC
low complexity region 1309 1318 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000152629
Predicted Effect probably damaging
Transcript: ENSMUST00000213154
AA Change: Q1981L

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000214971
Predicted Effect probably damaging
Transcript: ENSMUST00000216284
AA Change: Q1119L

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Meta Mutation Damage Score 0.3022 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.4%
Validation Efficiency 100% (51/51)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a centrosomal protein involved in microtubule organization, DNA damage response, and chromosome segregation. The encoded protein is required for assembly of primary cilia and localizes to mature centrioles. Defects in this gene are a cause of nephronophthisis-related ciliopathies. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Dec 2012]
Allele List at MGI
Other mutations in this stock
Total: 46 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310033P09Rik A G 11: 59,208,514 N29S probably damaging Het
4931409K22Rik C T 5: 24,554,526 G82E probably damaging Het
Ap1b1 T C 11: 5,015,737 V92A possibly damaging Het
Asgr1 G A 11: 70,056,249 R66Q probably benign Het
Atp8b4 T A 2: 126,358,860 Q796L probably damaging Het
Camk4 A C 18: 33,182,341 D307A probably damaging Het
Catsperb T A 12: 101,480,782 I223K probably benign Het
Ccdc80 A G 16: 45,118,105 Y725C probably damaging Het
Cep85l G A 10: 53,348,618 P292S probably damaging Het
Cfap53 A G 18: 74,329,505 probably null Het
Cts8 C A 13: 61,251,731 C138F probably damaging Het
Dis3l C A 9: 64,339,612 E54* probably null Het
Dnaja1 T A 4: 40,732,853 D367E probably benign Het
Duoxa2 T C 2: 122,299,174 I45T probably damaging Het
EU599041 C T 7: 43,225,909 noncoding transcript Het
Exoc5 T C 14: 49,015,479 M561V probably benign Het
Fam184a T C 10: 53,638,194 I296V probably damaging Het
Fbxl18 C T 5: 142,878,761 V686M probably damaging Het
Fryl A G 5: 73,064,975 S2088P probably damaging Het
Fus G A 7: 127,985,534 probably benign Het
Gm38394 A G 1: 133,658,079 S507P probably damaging Het
Gpr183 T A 14: 121,954,315 I265L probably benign Het
Herc1 T G 9: 66,439,901 L2013V probably benign Het
Ick C T 9: 78,131,487 T6M probably benign Het
Iqca T C 1: 90,081,344 K430R probably benign Het
Itpripl2 A G 7: 118,491,277 C20R probably damaging Het
Kmt2c C A 5: 25,287,112 C852F probably damaging Het
Lamb1 A T 12: 31,318,467 K1199* probably null Het
Lrba A G 3: 86,304,336 Y421C probably damaging Het
Lrig2 A G 3: 104,468,598 L96P probably benign Het
Mcc A G 18: 44,812,078 F29S possibly damaging Het
Mlh1 T C 9: 111,258,566 probably benign Het
Mpp5 T C 12: 78,819,371 probably benign Het
Rbm33 A G 5: 28,394,230 T867A unknown Het
Sdk1 T A 5: 142,046,292 S1041T probably benign Het
Serpinb2 A G 1: 107,523,964 probably null Het
Serpinb9d A G 13: 33,203,047 N366S possibly damaging Het
Sf3b1 A G 1: 55,007,633 S251P probably benign Het
Slc45a1 T C 4: 150,638,251 Y392C probably benign Het
Tlr4 T A 4: 66,839,983 C338S possibly damaging Het
Trio A G 15: 27,823,975 probably null Het
Vnn1 A T 10: 23,897,401 I109L probably benign Het
Wnk1 A G 6: 119,948,567 V1312A probably benign Het
Zfp28 A G 7: 6,394,498 H644R probably damaging Het
Zfp286 A G 11: 62,780,461 V262A probably damaging Het
Zfp292 A T 4: 34,807,962 M1694K probably benign Het
Other mutations in Cep164
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00983:Cep164 APN 9 45775256 missense possibly damaging 0.46
IGL01571:Cep164 APN 9 45794338 missense possibly damaging 0.82
IGL01985:Cep164 APN 9 45779606 missense probably damaging 1.00
IGL01989:Cep164 APN 9 45793015 splice site probably benign
IGL02130:Cep164 APN 9 45779792 missense possibly damaging 0.82
IGL02598:Cep164 APN 9 45770704 missense probably damaging 1.00
IGL03206:Cep164 APN 9 45802725 missense probably benign 0.00
R0063:Cep164 UTSW 9 45768618 missense possibly damaging 0.83
R0109:Cep164 UTSW 9 45771587 missense probably damaging 1.00
R0528:Cep164 UTSW 9 45776936 unclassified probably benign
R0532:Cep164 UTSW 9 45809826 nonsense probably null
R1445:Cep164 UTSW 9 45778900 missense possibly damaging 0.66
R1753:Cep164 UTSW 9 45792937 missense probably damaging 0.99
R1824:Cep164 UTSW 9 45778928 missense probably damaging 1.00
R1856:Cep164 UTSW 9 45775758 splice site probably null
R1858:Cep164 UTSW 9 45823640 splice site probably benign
R1900:Cep164 UTSW 9 45809825 missense probably damaging 1.00
R1911:Cep164 UTSW 9 45770806 missense probably benign 0.09
R2032:Cep164 UTSW 9 45771600 missense probably damaging 1.00
R2133:Cep164 UTSW 9 45803183 missense probably damaging 1.00
R2511:Cep164 UTSW 9 45775249 missense probably damaging 1.00
R4424:Cep164 UTSW 9 45779704 missense possibly damaging 0.92
R5126:Cep164 UTSW 9 45787424 critical splice donor site probably null
R5997:Cep164 UTSW 9 45769463 missense possibly damaging 0.92
R6186:Cep164 UTSW 9 45794109 missense probably damaging 0.98
R6357:Cep164 UTSW 9 45770884 missense probably damaging 1.00
R6385:Cep164 UTSW 9 45779783 missense probably damaging 0.99
R6632:Cep164 UTSW 9 45779790 missense possibly damaging 0.66
R6957:Cep164 UTSW 9 45772280 critical splice donor site probably null
R7310:Cep164 UTSW 9 45775366 missense probably damaging 1.00
R7420:Cep164 UTSW 9 45768542 missense probably benign 0.01
R7651:Cep164 UTSW 9 45773852 missense probably benign 0.18
X0024:Cep164 UTSW 9 45775863 critical splice donor site probably null
X0028:Cep164 UTSW 9 45770967 missense probably damaging 1.00
X0065:Cep164 UTSW 9 45774787 missense probably benign 0.03
Predicted Primers PCR Primer
(F):5'- CTGAGAGAAAGGGTCTACGGTC -3'
(R):5'- CTTCCTTTTGGGGAACTGATGC -3'

Sequencing Primer
(F):5'- CTACGGTCCAAAGGGGTATTCTC -3'
(R):5'- TTACCAGAGAAGGCCCTTTG -3'
Posted On2014-10-02