Mutagenetix > Incidental Mutations

Incidental Mutation 'R2186:Cep164'

237768

Institutional Source

Beutler Lab

Gene Symbol

Cep164

Ensembl Gene

ENSMUSG00000043987

Gene Name

centrosomal protein 164

Synonyms

MMRRC Submission

040188-MU

Accession Numbers

Is this an essential gene?

Essential (E-score: 1.000) question?

Stock #

R2186 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

45766946-45828691 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 45768578 bp

Zygosity

Heterozygous

Amino Acid Change

Glutamine to Leucine at position 1119 (Q1119L)

Ref Sequence

ENSEMBL: ENSMUSP00000150742 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000117194] [ENSMUST00000213154] [ENSMUST00000216284]

Predicted Effect

possibly damaging
Transcript: ENSMUST00000117194
AA Change: Q1280L

PolyPhen 2 Score 0.462 (Sensitivity: 0.89; Specificity: 0.90)

SMART Domains

Protein: ENSMUSP00000114053
Gene: ENSMUSG00000043987
AA Change: Q1280L

Domain	Start	End	E-Value	Type
WW	57	89	1.99e-3	SMART
low complexity region	110	127	N/A	INTRINSIC
low complexity region	189	201	N/A	INTRINSIC
low complexity region	210	229	N/A	INTRINSIC
low complexity region	362	375	N/A	INTRINSIC
coiled coil region	511	735	N/A	INTRINSIC
low complexity region	741	756	N/A	INTRINSIC
coiled coil region	761	931	N/A	INTRINSIC
low complexity region	956	962	N/A	INTRINSIC
coiled coil region	1057	1084	N/A	INTRINSIC
low complexity region	1095	1110	N/A	INTRINSIC
low complexity region	1141	1168	N/A	INTRINSIC
low complexity region	1185	1195	N/A	INTRINSIC
low complexity region	1235	1248	N/A	INTRINSIC
low complexity region	1309	1318	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000152629

Predicted Effect

probably damaging
Transcript: ENSMUST00000213154
AA Change: Q1981L

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000214971

Predicted Effect

probably damaging
Transcript: ENSMUST00000216284
AA Change: Q1119L

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

Meta Mutation Damage Score

0.3022

Coding Region Coverage

1x: 99.2%
3x: 98.6%
10x: 97.4%
20x: 95.4%

Validation Efficiency

100% (51/51)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a centrosomal protein involved in microtubule organization, DNA damage response, and chromosome segregation. The encoded protein is required for assembly of primary cilia and localizes to mature centrioles. Defects in this gene are a cause of nephronophthisis-related ciliopathies. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Dec 2012]

Allele List at MGI

Other mutations in this stock

Total: 46 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2310033P09Rik	A	G	11: 59,208,514	N29S	probably damaging	Het
4931409K22Rik	C	T	5: 24,554,526	G82E	probably damaging	Het
Ap1b1	T	C	11: 5,015,737	V92A	possibly damaging	Het
Asgr1	G	A	11: 70,056,249	R66Q	probably benign	Het
Atp8b4	T	A	2: 126,358,860	Q796L	probably damaging	Het
Camk4	A	C	18: 33,182,341	D307A	probably damaging	Het
Catsperb	T	A	12: 101,480,782	I223K	probably benign	Het
Ccdc80	A	G	16: 45,118,105	Y725C	probably damaging	Het
Cep85l	G	A	10: 53,348,618	P292S	probably damaging	Het
Cfap53	A	G	18: 74,329,505		probably null	Het
Cts8	C	A	13: 61,251,731	C138F	probably damaging	Het
Dis3l	C	A	9: 64,339,612	E54*	probably null	Het
Dnaja1	T	A	4: 40,732,853	D367E	probably benign	Het
Duoxa2	T	C	2: 122,299,174	I45T	probably damaging	Het
EU599041	C	T	7: 43,225,909		noncoding transcript	Het
Exoc5	T	C	14: 49,015,479	M561V	probably benign	Het
Fam184a	T	C	10: 53,638,194	I296V	probably damaging	Het
Fbxl18	C	T	5: 142,878,761	V686M	probably damaging	Het
Fryl	A	G	5: 73,064,975	S2088P	probably damaging	Het
Fus	G	A	7: 127,985,534		probably benign	Het
Gm38394	A	G	1: 133,658,079	S507P	probably damaging	Het
Gpr183	T	A	14: 121,954,315	I265L	probably benign	Het
Herc1	T	G	9: 66,439,901	L2013V	probably benign	Het
Ick	C	T	9: 78,131,487	T6M	probably benign	Het
Iqca	T	C	1: 90,081,344	K430R	probably benign	Het
Itpripl2	A	G	7: 118,491,277	C20R	probably damaging	Het
Kmt2c	C	A	5: 25,287,112	C852F	probably damaging	Het
Lamb1	A	T	12: 31,318,467	K1199*	probably null	Het
Lrba	A	G	3: 86,304,336	Y421C	probably damaging	Het
Lrig2	A	G	3: 104,468,598	L96P	probably benign	Het
Mcc	A	G	18: 44,812,078	F29S	possibly damaging	Het
Mlh1	T	C	9: 111,258,566		probably benign	Het
Mpp5	T	C	12: 78,819,371		probably benign	Het
Rbm33	A	G	5: 28,394,230	T867A	unknown	Het
Sdk1	T	A	5: 142,046,292	S1041T	probably benign	Het
Serpinb2	A	G	1: 107,523,964		probably null	Het
Serpinb9d	A	G	13: 33,203,047	N366S	possibly damaging	Het
Sf3b1	A	G	1: 55,007,633	S251P	probably benign	Het
Slc45a1	T	C	4: 150,638,251	Y392C	probably benign	Het
Tlr4	T	A	4: 66,839,983	C338S	possibly damaging	Het
Trio	A	G	15: 27,823,975		probably null	Het
Vnn1	A	T	10: 23,897,401	I109L	probably benign	Het
Wnk1	A	G	6: 119,948,567	V1312A	probably benign	Het
Zfp28	A	G	7: 6,394,498	H644R	probably damaging	Het
Zfp286	A	G	11: 62,780,461	V262A	probably damaging	Het
Zfp292	A	T	4: 34,807,962	M1694K	probably benign	Het

Other mutations in Cep164

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00983:Cep164	APN	9	45775256	missense	possibly damaging	0.46
IGL01571:Cep164	APN	9	45794338	missense	possibly damaging	0.82
IGL01985:Cep164	APN	9	45779606	missense	probably damaging	1.00
IGL01989:Cep164	APN	9	45793015	splice site	probably benign
IGL02130:Cep164	APN	9	45779792	missense	possibly damaging	0.82
IGL02598:Cep164	APN	9	45770704	missense	probably damaging	1.00
IGL03206:Cep164	APN	9	45802725	missense	probably benign	0.00
R0063:Cep164	UTSW	9	45768618	missense	possibly damaging	0.83
R0109:Cep164	UTSW	9	45771587	missense	probably damaging	1.00
R0528:Cep164	UTSW	9	45776936	unclassified	probably benign
R0532:Cep164	UTSW	9	45809826	nonsense	probably null
R1445:Cep164	UTSW	9	45778900	missense	possibly damaging	0.66
R1753:Cep164	UTSW	9	45792937	missense	probably damaging	0.99
R1824:Cep164	UTSW	9	45778928	missense	probably damaging	1.00
R1856:Cep164	UTSW	9	45775758	splice site	probably null
R1858:Cep164	UTSW	9	45823640	splice site	probably benign
R1900:Cep164	UTSW	9	45809825	missense	probably damaging	1.00
R1911:Cep164	UTSW	9	45770806	missense	probably benign	0.09
R2032:Cep164	UTSW	9	45771600	missense	probably damaging	1.00
R2133:Cep164	UTSW	9	45803183	missense	probably damaging	1.00
R2511:Cep164	UTSW	9	45775249	missense	probably damaging	1.00
R4424:Cep164	UTSW	9	45779704	missense	possibly damaging	0.92
R5126:Cep164	UTSW	9	45787424	critical splice donor site	probably null
R5997:Cep164	UTSW	9	45769463	missense	possibly damaging	0.92
R6186:Cep164	UTSW	9	45794109	missense	probably damaging	0.98
R6357:Cep164	UTSW	9	45770884	missense	probably damaging	1.00
R6385:Cep164	UTSW	9	45779783	missense	probably damaging	0.99
R6632:Cep164	UTSW	9	45779790	missense	possibly damaging	0.66
R6957:Cep164	UTSW	9	45772280	critical splice donor site	probably null
R7310:Cep164	UTSW	9	45775366	missense	probably damaging	1.00
R7420:Cep164	UTSW	9	45768542	missense	probably benign	0.01
R7651:Cep164	UTSW	9	45773852	missense	probably benign	0.18
X0024:Cep164	UTSW	9	45775863	critical splice donor site	probably null
X0028:Cep164	UTSW	9	45770967	missense	probably damaging	1.00
X0065:Cep164	UTSW	9	45774787	missense	probably benign	0.03

Predicted Primers

PCR Primer
(F):5'- CTGAGAGAAAGGGTCTACGGTC -3'
(R):5'- CTTCCTTTTGGGGAACTGATGC -3'

Sequencing Primer
(F):5'- CTACGGTCCAAAGGGGTATTCTC -3'
(R):5'- TTACCAGAGAAGGCCCTTTG -3'

Posted On

2014-10-02