Incidental Mutation 'R2186:Cep85l'
ID237776
Institutional Source Beutler Lab
Gene Symbol Cep85l
Ensembl Gene ENSMUSG00000038594
Gene Namecentrosomal protein 85-like
SynonymsGm9766
MMRRC Submission 040188-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.255) question?
Stock #R2186 (G1)
Quality Score225
Status Validated
Chromosome10
Chromosomal Location53273443-53379947 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 53348618 bp
ZygosityHeterozygous
Amino Acid Change Proline to Serine at position 292 (P292S)
Ref Sequence ENSEMBL: ENSMUSP00000151909 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000046221] [ENSMUST00000095691] [ENSMUST00000163319] [ENSMUST00000218468] [ENSMUST00000219491] [ENSMUST00000219921] [ENSMUST00000220197] [ENSMUST00000220376] [ENSMUST00000220443]
Predicted Effect probably benign
Transcript: ENSMUST00000046221
SMART Domains Protein: ENSMUSP00000045709
Gene: ENSMUSG00000038583

DomainStartEndE-ValueType
Pfam:Phospholamban 1 52 2.7e-41 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000095691
AA Change: P190S

PolyPhen 2 Score 0.903 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000093356
Gene: ENSMUSG00000038594
AA Change: P190S

DomainStartEndE-ValueType
coiled coil region 442 578 N/A INTRINSIC
coiled coil region 600 645 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000163319
SMART Domains Protein: ENSMUSP00000132743
Gene: ENSMUSG00000038583

DomainStartEndE-ValueType
Pfam:Phospholamban 1 52 2.7e-41 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000218351
Predicted Effect probably benign
Transcript: ENSMUST00000218468
Predicted Effect noncoding transcript
Transcript: ENSMUST00000218596
Predicted Effect probably benign
Transcript: ENSMUST00000219491
Predicted Effect probably benign
Transcript: ENSMUST00000219921
Predicted Effect probably benign
Transcript: ENSMUST00000220197
Predicted Effect possibly damaging
Transcript: ENSMUST00000220376
AA Change: P190S

PolyPhen 2 Score 0.903 (Sensitivity: 0.82; Specificity: 0.94)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000220401
Predicted Effect probably damaging
Transcript: ENSMUST00000220443
AA Change: P292S

PolyPhen 2 Score 0.973 (Sensitivity: 0.76; Specificity: 0.96)
Meta Mutation Damage Score 0.1410 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.4%
Validation Efficiency 100% (51/51)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene was identified as a breast cancer antigen. Nothing more is known of its function at this time. Three transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, May 2010]
Allele List at MGI
Other mutations in this stock
Total: 46 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310033P09Rik A G 11: 59,208,514 N29S probably damaging Het
4931409K22Rik C T 5: 24,554,526 G82E probably damaging Het
Ap1b1 T C 11: 5,015,737 V92A possibly damaging Het
Asgr1 G A 11: 70,056,249 R66Q probably benign Het
Atp8b4 T A 2: 126,358,860 Q796L probably damaging Het
Camk4 A C 18: 33,182,341 D307A probably damaging Het
Catsperb T A 12: 101,480,782 I223K probably benign Het
Ccdc80 A G 16: 45,118,105 Y725C probably damaging Het
Cep164 T A 9: 45,768,578 Q1119L probably damaging Het
Cfap53 A G 18: 74,329,505 probably null Het
Cts8 C A 13: 61,251,731 C138F probably damaging Het
Dis3l C A 9: 64,339,612 E54* probably null Het
Dnaja1 T A 4: 40,732,853 D367E probably benign Het
Duoxa2 T C 2: 122,299,174 I45T probably damaging Het
EU599041 C T 7: 43,225,909 noncoding transcript Het
Exoc5 T C 14: 49,015,479 M561V probably benign Het
Fam184a T C 10: 53,638,194 I296V probably damaging Het
Fbxl18 C T 5: 142,878,761 V686M probably damaging Het
Fryl A G 5: 73,064,975 S2088P probably damaging Het
Fus G A 7: 127,985,534 probably benign Het
Gm38394 A G 1: 133,658,079 S507P probably damaging Het
Gpr183 T A 14: 121,954,315 I265L probably benign Het
Herc1 T G 9: 66,439,901 L2013V probably benign Het
Ick C T 9: 78,131,487 T6M probably benign Het
Iqca T C 1: 90,081,344 K430R probably benign Het
Itpripl2 A G 7: 118,491,277 C20R probably damaging Het
Kmt2c C A 5: 25,287,112 C852F probably damaging Het
Lamb1 A T 12: 31,318,467 K1199* probably null Het
Lrba A G 3: 86,304,336 Y421C probably damaging Het
Lrig2 A G 3: 104,468,598 L96P probably benign Het
Mcc A G 18: 44,812,078 F29S possibly damaging Het
Mlh1 T C 9: 111,258,566 probably benign Het
Mpp5 T C 12: 78,819,371 probably benign Het
Rbm33 A G 5: 28,394,230 T867A unknown Het
Sdk1 T A 5: 142,046,292 S1041T probably benign Het
Serpinb2 A G 1: 107,523,964 probably null Het
Serpinb9d A G 13: 33,203,047 N366S possibly damaging Het
Sf3b1 A G 1: 55,007,633 S251P probably benign Het
Slc45a1 T C 4: 150,638,251 Y392C probably benign Het
Tlr4 T A 4: 66,839,983 C338S possibly damaging Het
Trio A G 15: 27,823,975 probably null Het
Vnn1 A T 10: 23,897,401 I109L probably benign Het
Wnk1 A G 6: 119,948,567 V1312A probably benign Het
Zfp28 A G 7: 6,394,498 H644R probably damaging Het
Zfp286 A G 11: 62,780,461 V262A probably damaging Het
Zfp292 A T 4: 34,807,962 M1694K probably benign Het
Other mutations in Cep85l
AlleleSourceChrCoordTypePredicted EffectPPH Score
R0103:Cep85l UTSW 10 53278174 missense possibly damaging 0.53
R0103:Cep85l UTSW 10 53278174 missense possibly damaging 0.53
R0559:Cep85l UTSW 10 53348501 missense probably benign 0.00
R0689:Cep85l UTSW 10 53348847 missense probably damaging 1.00
R0750:Cep85l UTSW 10 53281546 missense probably damaging 0.99
R0969:Cep85l UTSW 10 53281496 missense probably benign 0.00
R1375:Cep85l UTSW 10 53349258 missense probably damaging 0.99
R1542:Cep85l UTSW 10 53301584 missense probably damaging 1.00
R1611:Cep85l UTSW 10 53348681 missense probably benign
R1749:Cep85l UTSW 10 53278154 missense probably damaging 1.00
R1826:Cep85l UTSW 10 53348812 missense possibly damaging 0.89
R2007:Cep85l UTSW 10 53278075 utr 3 prime probably benign
R2043:Cep85l UTSW 10 53358128 missense possibly damaging 0.64
R2144:Cep85l UTSW 10 53358126 missense probably benign 0.04
R2201:Cep85l UTSW 10 53348731 missense probably benign 0.01
R3767:Cep85l UTSW 10 53291810 missense probably benign 0.09
R5249:Cep85l UTSW 10 53319594 splice site probably null
R5764:Cep85l UTSW 10 53348994 missense probably benign 0.00
R6207:Cep85l UTSW 10 53281555 missense probably benign
R6333:Cep85l UTSW 10 53349101 nonsense probably null
R6422:Cep85l UTSW 10 53291780 missense possibly damaging 0.62
R6511:Cep85l UTSW 10 53278092 missense probably benign 0.00
R6645:Cep85l UTSW 10 53301672 missense probably benign 0.26
R6863:Cep85l UTSW 10 53349118 missense probably damaging 1.00
R6904:Cep85l UTSW 10 53349098 missense probably benign 0.00
R7000:Cep85l UTSW 10 53298199 missense probably damaging 1.00
R7015:Cep85l UTSW 10 53349055 missense possibly damaging 0.89
R7256:Cep85l UTSW 10 53296255 missense probably damaging 1.00
R7425:Cep85l UTSW 10 53301570 missense probably damaging 1.00
R7583:Cep85l UTSW 10 53281354 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ACATAAAACATCCACTGGAGGG -3'
(R):5'- GGTCATCAACTCTGGACTGC -3'

Sequencing Primer
(F):5'- CATCCACTGGAGGGAAGCAAAC -3'
(R):5'- ATTTGAGAGCTGCAACAAAGAAGATG -3'
Posted On2014-10-02