Incidental Mutation 'R2186:Exoc5'
ID237789
Institutional Source Beutler Lab
Gene Symbol Exoc5
Ensembl Gene ENSMUSG00000061244
Gene Nameexocyst complex component 5
SynonymsSec10l1, SEC10, PRO1912
MMRRC Submission 040188-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.918) question?
Stock #R2186 (G1)
Quality Score225
Status Validated
Chromosome14
Chromosomal Location49004090-49066653 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 49015479 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Valine at position 561 (M561V)
Ref Sequence ENSEMBL: ENSMUSP00000124012 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000161504] [ENSMUST00000162175]
Predicted Effect noncoding transcript
Transcript: ENSMUST00000159651
Predicted Effect noncoding transcript
Transcript: ENSMUST00000160453
Predicted Effect noncoding transcript
Transcript: ENSMUST00000160833
Predicted Effect probably benign
Transcript: ENSMUST00000161504
AA Change: M561V

PolyPhen 2 Score 0.080 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000124012
Gene: ENSMUSG00000061244
AA Change: M561V

DomainStartEndE-ValueType
Pfam:Sec10 43 175 9.5e-24 PFAM
Pfam:Sec10 175 642 1.1e-119 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000162175
AA Change: M626V

PolyPhen 2 Score 0.044 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000125434
Gene: ENSMUSG00000061244
AA Change: M626V

DomainStartEndE-ValueType
Pfam:Sec10 89 707 6.6e-154 PFAM
Meta Mutation Damage Score 0.0638 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.4%
Validation Efficiency 100% (51/51)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a component of the exocyst complex, a multiple protein complex essential for targeting exocytic vesicles to specific docking sites on the plasma membrane. Though best characterized in yeast, the component proteins and functions of exocyst complex have been demonstrated to be highly conserved in higher eukaryotes. At least eight components of the exocyst complex, including this protein, are found to interact with the actin cytoskeletal remodeling and vesicle transport machinery. The complex is also essential for the biogenesis of epithelial cell surface polarity. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a conditional allele activated in all cells die prior to E8.5. Mice homozygous for a conditional allele activated in kidney cells exhibit ureteropelvic junction obstructions leading to neontal death. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 46 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310033P09Rik A G 11: 59,208,514 N29S probably damaging Het
4931409K22Rik C T 5: 24,554,526 G82E probably damaging Het
Ap1b1 T C 11: 5,015,737 V92A possibly damaging Het
Asgr1 G A 11: 70,056,249 R66Q probably benign Het
Atp8b4 T A 2: 126,358,860 Q796L probably damaging Het
Camk4 A C 18: 33,182,341 D307A probably damaging Het
Catsperb T A 12: 101,480,782 I223K probably benign Het
Ccdc80 A G 16: 45,118,105 Y725C probably damaging Het
Cep164 T A 9: 45,768,578 Q1119L probably damaging Het
Cep85l G A 10: 53,348,618 P292S probably damaging Het
Cfap53 A G 18: 74,329,505 probably null Het
Cts8 C A 13: 61,251,731 C138F probably damaging Het
Dis3l C A 9: 64,339,612 E54* probably null Het
Dnaja1 T A 4: 40,732,853 D367E probably benign Het
Duoxa2 T C 2: 122,299,174 I45T probably damaging Het
EU599041 C T 7: 43,225,909 noncoding transcript Het
Fam184a T C 10: 53,638,194 I296V probably damaging Het
Fbxl18 C T 5: 142,878,761 V686M probably damaging Het
Fryl A G 5: 73,064,975 S2088P probably damaging Het
Fus G A 7: 127,985,534 probably benign Het
Gm38394 A G 1: 133,658,079 S507P probably damaging Het
Gpr183 T A 14: 121,954,315 I265L probably benign Het
Herc1 T G 9: 66,439,901 L2013V probably benign Het
Ick C T 9: 78,131,487 T6M probably benign Het
Iqca T C 1: 90,081,344 K430R probably benign Het
Itpripl2 A G 7: 118,491,277 C20R probably damaging Het
Kmt2c C A 5: 25,287,112 C852F probably damaging Het
Lamb1 A T 12: 31,318,467 K1199* probably null Het
Lrba A G 3: 86,304,336 Y421C probably damaging Het
Lrig2 A G 3: 104,468,598 L96P probably benign Het
Mcc A G 18: 44,812,078 F29S possibly damaging Het
Mlh1 T C 9: 111,258,566 probably benign Het
Mpp5 T C 12: 78,819,371 probably benign Het
Rbm33 A G 5: 28,394,230 T867A unknown Het
Sdk1 T A 5: 142,046,292 S1041T probably benign Het
Serpinb2 A G 1: 107,523,964 probably null Het
Serpinb9d A G 13: 33,203,047 N366S possibly damaging Het
Sf3b1 A G 1: 55,007,633 S251P probably benign Het
Slc45a1 T C 4: 150,638,251 Y392C probably benign Het
Tlr4 T A 4: 66,839,983 C338S possibly damaging Het
Trio A G 15: 27,823,975 probably null Het
Vnn1 A T 10: 23,897,401 I109L probably benign Het
Wnk1 A G 6: 119,948,567 V1312A probably benign Het
Zfp28 A G 7: 6,394,498 H644R probably damaging Het
Zfp286 A G 11: 62,780,461 V262A probably damaging Het
Zfp292 A T 4: 34,807,962 M1694K probably benign Het
Other mutations in Exoc5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01010:Exoc5 APN 14 49037755 missense probably damaging 1.00
IGL01473:Exoc5 APN 14 49014294 missense possibly damaging 0.83
IGL01599:Exoc5 APN 14 49034964 missense probably benign 0.00
IGL01702:Exoc5 APN 14 49015615 nonsense probably null
IGL02173:Exoc5 APN 14 49034801 splice site probably benign
IGL02211:Exoc5 APN 14 49014210 missense probably damaging 1.00
IGL02874:Exoc5 APN 14 49051446 missense probably benign 0.02
IGL02968:Exoc5 APN 14 49033269 critical splice donor site probably null
IGL03167:Exoc5 APN 14 49051345 missense probably damaging 1.00
IGL03207:Exoc5 APN 14 49033375 missense probably benign
PIT4260001:Exoc5 UTSW 14 49048765 missense probably benign 0.01
R0139:Exoc5 UTSW 14 49036036 missense probably damaging 1.00
R0594:Exoc5 UTSW 14 49036087 splice site probably benign
R0945:Exoc5 UTSW 14 49039342 splice site probably benign
R1968:Exoc5 UTSW 14 49034890 missense probably benign 0.27
R2082:Exoc5 UTSW 14 49015587 missense probably benign 0.07
R2356:Exoc5 UTSW 14 49016281 missense probably benign 0.00
R3419:Exoc5 UTSW 14 49023278 missense probably damaging 1.00
R3743:Exoc5 UTSW 14 49033407 nonsense probably null
R3743:Exoc5 UTSW 14 49014349 missense probably benign 0.00
R3870:Exoc5 UTSW 14 49019396 splice site probably benign
R4273:Exoc5 UTSW 14 49015480 nonsense probably null
R4794:Exoc5 UTSW 14 49048900 critical splice acceptor site probably null
R4853:Exoc5 UTSW 14 49052369 small deletion probably benign
R4864:Exoc5 UTSW 14 49052382 missense probably benign 0.00
R4883:Exoc5 UTSW 14 49052364 missense probably damaging 1.00
R5098:Exoc5 UTSW 14 49048847 missense possibly damaging 0.90
R5965:Exoc5 UTSW 14 49034931 missense probably damaging 1.00
R6036:Exoc5 UTSW 14 49014322 missense possibly damaging 0.82
R6036:Exoc5 UTSW 14 49014322 missense possibly damaging 0.82
R6820:Exoc5 UTSW 14 49048930 intron probably null
Predicted Primers PCR Primer
(F):5'- TAAAGCTGTCTCTTAATGCTGCCA -3'
(R):5'- ATTCTTGTACACGCATTAGTGC -3'

Sequencing Primer
(F):5'- TGCCAGCGAAATCACACATTTC -3'
(R):5'- TTGCTGGGAATGAGCTACACCAC -3'
Posted On2014-10-02