Incidental Mutation 'R0178:Nrg3'
ID23779
Institutional Source Beutler Lab
Gene Symbol Nrg3
Ensembl Gene ENSMUSG00000041014
Gene Nameneuregulin 3
Synonymsska
MMRRC Submission 038446-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.159) question?
Stock #R0178 (G1)
Quality Score225
Status Validated (trace)
Chromosome14
Chromosomal Location38368952-39473088 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 38376456 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Glutamine at position 480 (H480Q)
Ref Sequence ENSEMBL: ENSMUSP00000136884 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000166968] [ENSMUST00000168810] [ENSMUST00000173780]
Predicted Effect probably damaging
Transcript: ENSMUST00000166968
AA Change: H480Q

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000136884
Gene: ENSMUSG00000041014
AA Change: H480Q

DomainStartEndE-ValueType
low complexity region 2 49 N/A INTRINSIC
transmembrane domain 69 91 N/A INTRINSIC
low complexity region 127 148 N/A INTRINSIC
low complexity region 195 208 N/A INTRINSIC
low complexity region 254 274 N/A INTRINSIC
EGF 291 331 3.57e-2 SMART
Pfam:Neuregulin 355 480 3.3e-12 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000168810
AA Change: H488Q

PolyPhen 2 Score 0.986 (Sensitivity: 0.74; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000129783
Gene: ENSMUSG00000041014
AA Change: H488Q

DomainStartEndE-ValueType
low complexity region 2 49 N/A INTRINSIC
transmembrane domain 69 91 N/A INTRINSIC
low complexity region 127 148 N/A INTRINSIC
low complexity region 195 208 N/A INTRINSIC
low complexity region 254 274 N/A INTRINSIC
EGF 291 331 3.57e-2 SMART
transmembrane domain 363 385 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000173780
AA Change: H480Q

PolyPhen 2 Score 0.986 (Sensitivity: 0.74; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000134727
Gene: ENSMUSG00000041014
AA Change: H480Q

DomainStartEndE-ValueType
low complexity region 2 49 N/A INTRINSIC
transmembrane domain 69 91 N/A INTRINSIC
low complexity region 127 148 N/A INTRINSIC
low complexity region 195 208 N/A INTRINSIC
low complexity region 254 274 N/A INTRINSIC
EGF 291 331 3.57e-2 SMART
transmembrane domain 363 385 N/A INTRINSIC
Meta Mutation Damage Score 0.1029 question?
Coding Region Coverage
  • 1x: 98.9%
  • 3x: 98.1%
  • 10x: 95.5%
  • 20x: 88.8%
Validation Efficiency 95% (69/73)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the neuregulin gene family. This gene family encodes ligands for the transmembrane tyrosine kinase receptors ERBB3 and ERBB4 - members of the epidermal growth factor receptor family. Ligand binding activates intracellular signaling cascades and the induction of cellular responses including proliferation, migration, differentiation, and survival or apoptosis. This gene encodes neuregulin 3 (NRG3). NRG3 has been shown to activate the tyrosine phosphorylation of its cognate receptor, ERBB4, and is thought to influence neuroblast proliferation, migration and differentiation by signalling through ERBB4. NRG3 also promotes mammary differentiation during embryogenesis. Linkage studies have implicated this gene as a susceptibility locus for schizophrenia and schizoaffective disorder. Alternative splicing results in multiple transcript variants encoding distinct isoforms. Additional transcript variants have been described but their biological validity has not been verified.[provided by RefSeq, Sep 2009]
PHENOTYPE: Mutations in this gene result in abnormal, genetic background specific, mammary gland development. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 53 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700125H20Rik A G 11: 85,178,438 H94R probably benign Het
4922502D21Rik T C 6: 129,326,823 R60G probably benign Het
4930596D02Rik T G 14: 35,811,478 N111T probably benign Het
9930021J03Rik A G 19: 29,754,788 S342P probably damaging Het
Abca1 T C 4: 53,081,953 D769G possibly damaging Het
Adcy6 G T 15: 98,604,215 Q173K probably benign Het
Amotl1 G A 9: 14,548,773 A890V probably benign Het
Arfgap2 C T 2: 91,267,361 A141V probably benign Het
Asb2 G A 12: 103,325,552 P324L probably damaging Het
Cacna1g G A 11: 94,463,483 T202I probably damaging Het
Capn5 A G 7: 98,132,891 L214P probably damaging Het
Cdh20 A T 1: 104,975,051 D489V possibly damaging Het
Cers5 C A 15: 99,747,024 probably benign Het
Chrnb3 T A 8: 27,393,364 V111D probably damaging Het
Colec12 C T 18: 9,858,921 P568L unknown Het
Cyp2r1 T C 7: 114,550,408 E248G probably damaging Het
Dnmt3b A G 2: 153,675,018 T536A probably benign Het
Eef2 G A 10: 81,180,292 V496M possibly damaging Het
Fam118a T C 15: 85,045,880 probably benign Het
Fer1l6 T A 15: 58,637,914 probably null Het
Fhad1 A C 4: 141,955,340 F497V probably benign Het
Gbe1 G A 16: 70,478,386 G358D probably damaging Het
Gdf10 A G 14: 33,924,101 D69G probably damaging Het
Ggt6 A G 11: 72,436,818 H150R possibly damaging Het
Gm1966 A T 7: 106,601,821 Y739N probably damaging Het
Gm45713 A T 7: 45,134,458 L110Q probably damaging Het
Gm9847 T C 12: 14,494,648 noncoding transcript Het
Grwd1 T C 7: 45,830,630 E51G probably damaging Het
H13 A G 2: 152,681,067 Y100C probably damaging Het
Kcne1 A C 16: 92,348,809 M49R probably damaging Het
Kcnma1 C T 14: 23,526,767 R236H probably damaging Het
Knl1 T A 2: 119,058,405 probably benign Het
Krt40 T C 11: 99,541,739 I150M probably damaging Het
Ldb2 A T 5: 44,473,499 V300E probably damaging Het
Lrp1b A T 2: 40,725,907 C3606S probably damaging Het
Lrrc42 A G 4: 107,247,720 I16T probably damaging Het
Lrrc6 A C 15: 66,454,101 D208E probably benign Het
Mtus1 G T 8: 41,002,361 L87I possibly damaging Het
Myot T C 18: 44,336,986 F10S probably damaging Het
Olfr205 A T 16: 59,329,420 F30I probably damaging Het
Olfr691 G A 7: 105,336,922 R265C probably benign Het
Prl2c5 A T 13: 13,191,805 D220V probably damaging Het
Rbm17 G A 2: 11,587,779 S295L probably benign Het
Serpina6 A G 12: 103,646,913 I376T probably damaging Het
Sh2d2a A T 3: 87,849,423 T192S probably benign Het
Slc27a1 T C 8: 71,584,462 Y417H possibly damaging Het
Slc6a1 T G 6: 114,304,852 I32S possibly damaging Het
Sntb1 T C 15: 55,906,144 T150A probably damaging Het
Tanc1 T A 2: 59,835,447 C1183* probably null Het
Tmprss7 C A 16: 45,690,843 W57C probably damaging Het
Ubac1 A T 2: 26,021,428 V36E possibly damaging Het
Zfc3h1 T C 10: 115,406,725 probably benign Het
Zfp644 C T 5: 106,636,905 C592Y probably damaging Het
Other mutations in Nrg3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00703:Nrg3 APN 14 38370801 missense probably damaging 0.99
IGL01994:Nrg3 APN 14 39012086 missense probably damaging 1.00
IGL02002:Nrg3 APN 14 38370767 nonsense probably null
IGL02247:Nrg3 APN 14 38371312 missense probably damaging 0.98
IGL02967:Nrg3 APN 14 38668299 splice site probably benign
R6803_Nrg3_459 UTSW 14 39012000 nonsense probably null
FR4304:Nrg3 UTSW 14 38397273 small insertion probably benign
FR4449:Nrg3 UTSW 14 38397271 small insertion probably benign
FR4548:Nrg3 UTSW 14 38397271 small insertion probably benign
FR4589:Nrg3 UTSW 14 38397266 small insertion probably benign
R0825:Nrg3 UTSW 14 39472391 missense possibly damaging 0.67
R1545:Nrg3 UTSW 14 38407154 missense probably benign 0.03
R2009:Nrg3 UTSW 14 38370814 missense probably damaging 0.99
R2022:Nrg3 UTSW 14 38376352 missense probably damaging 0.98
R2264:Nrg3 UTSW 14 38381702 missense probably damaging 1.00
R2937:Nrg3 UTSW 14 38371008 missense possibly damaging 0.94
R2958:Nrg3 UTSW 14 39472712 missense unknown
R3085:Nrg3 UTSW 14 38370949 missense probably damaging 0.99
R3801:Nrg3 UTSW 14 38376434 missense probably damaging 0.96
R3803:Nrg3 UTSW 14 38376434 missense probably damaging 0.96
R4246:Nrg3 UTSW 14 39472241 missense possibly damaging 0.58
R5584:Nrg3 UTSW 14 39472697 small deletion probably benign
R5625:Nrg3 UTSW 14 38370993 missense probably damaging 0.99
R5870:Nrg3 UTSW 14 39472629 missense possibly damaging 0.95
R6007:Nrg3 UTSW 14 39472452 nonsense probably null
R6047:Nrg3 UTSW 14 38397352 critical splice acceptor site probably null
R6294:Nrg3 UTSW 14 38397239 missense probably benign 0.00
R6803:Nrg3 UTSW 14 39012000 nonsense probably null
R7023:Nrg3 UTSW 14 38376376 missense probably damaging 1.00
R7159:Nrg3 UTSW 14 38370735 nonsense probably null
R7194:Nrg3 UTSW 14 39472478 missense probably benign 0.17
R7297:Nrg3 UTSW 14 38370939 missense probably benign 0.10
R7413:Nrg3 UTSW 14 38370712 missense probably damaging 0.99
R7474:Nrg3 UTSW 14 39011999 missense probably damaging 0.98
R7684:Nrg3 UTSW 14 39472565 missense probably damaging 1.00
R7848:Nrg3 UTSW 14 38668283 missense probably damaging 1.00
R8342:Nrg3 UTSW 14 39012096 missense probably damaging 1.00
R8435:Nrg3 UTSW 14 39472697 small deletion probably benign
X0020:Nrg3 UTSW 14 38397241 missense probably benign 0.01
Z1176:Nrg3 UTSW 14 39472533 missense possibly damaging 0.88
Predicted Primers PCR Primer
(F):5'- AGTCTCCCATGTAAGTCCCTTGCTG -3'
(R):5'- GGCCAGGAACACAAGGAATTGTCTC -3'

Sequencing Primer
(F):5'- CCATGTAAGTCCCTTGCTGTAAAAC -3'
(R):5'- AGGAATTGTCTCTCAGCACC -3'
Posted On2013-04-16