Mutagenetix > Incidental Mutations

Incidental Mutation 'R2186:Trio'

237791

Institutional Source

Beutler Lab

Gene Symbol

Trio

Ensembl Gene

ENSMUSG00000022263

Gene Name

triple functional domain (PTPRF interacting)

Synonyms

Solo, 6720464I07Rik

MMRRC Submission

040188-MU

Accession Numbers

Is this an essential gene?

Essential (E-score: 1.000) question?

Stock #

R2186 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

27730651-28025848 bp(-) (GRCm38)

Type of Mutation

splice site (6 bp from exon)

DNA Base Change (assembly)

A to G at 27823975 bp

Zygosity

Heterozygous

Amino Acid Change

Ref Sequence

ENSEMBL: ENSMUSP00000154653 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000090247] [ENSMUST00000226644] [ENSMUST00000227337]

Predicted Effect

probably null
Transcript: ENSMUST00000090247

SMART Domains

Protein: ENSMUSP00000087714
Gene: ENSMUSG00000022263

Domain	Start	End	E-Value	Type
low complexity region	2	40	N/A	INTRINSIC
SEC14	68	207	3.4e-26	SMART
SPEC	221	337	2.48e-9	SMART
SPEC	343	445	1.92e-15	SMART
SPEC	569	671	5.35e-14	SMART
SPEC	674	783	1.18e-6	SMART
SPEC	910	1011	2.6e-12	SMART
SPEC	1141	1243	7e-18	SMART
low complexity region	1249	1258	N/A	INTRINSIC
RhoGEF	1296	1466	2.79e-53	SMART
PH	1480	1593	1.53e-9	SMART
SH3	1659	1720	1.9e-8	SMART
low complexity region	1788	1802	N/A	INTRINSIC
low complexity region	1837	1863	N/A	INTRINSIC
low complexity region	1936	1954	N/A	INTRINSIC
RhoGEF	1973	2144	1.32e-63	SMART
PH	2158	2273	3.6e-6	SMART
low complexity region	2291	2341	N/A	INTRINSIC
low complexity region	2371	2390	N/A	INTRINSIC
low complexity region	2491	2503	N/A	INTRINSIC
SH3	2558	2619	1.04e0	SMART
low complexity region	2640	2660	N/A	INTRINSIC
IGc2	2701	2770	4e-12	SMART
S_TKc	2800	3054	4.84e-72	SMART

Predicted Effect

probably null
Transcript: ENSMUST00000226644

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000227044

Predicted Effect

probably null
Transcript: ENSMUST00000227337

Meta Mutation Damage Score

0.9755

Coding Region Coverage

1x: 99.2%
3x: 98.6%
10x: 97.4%
20x: 95.4%

Validation Efficiency

100% (51/51)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a large protein that functions as a GDP to GTP exchange factor. This protein promotes the reorganization of the actin cytoskeleton, thereby playing a role in cell migration and growth. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Dec 2015]
PHENOTYPE: Homozygous mutant mice die during late embryonic development or shortly after birth. They exhibit abnormal skeletal myogenesis and display aberrant organization within the hippocampus and olfactory bulb. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 46 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2310033P09Rik	A	G	11: 59,208,514	N29S	probably damaging	Het
4931409K22Rik	C	T	5: 24,554,526	G82E	probably damaging	Het
Ap1b1	T	C	11: 5,015,737	V92A	possibly damaging	Het
Asgr1	G	A	11: 70,056,249	R66Q	probably benign	Het
Atp8b4	T	A	2: 126,358,860	Q796L	probably damaging	Het
Camk4	A	C	18: 33,182,341	D307A	probably damaging	Het
Catsperb	T	A	12: 101,480,782	I223K	probably benign	Het
Ccdc80	A	G	16: 45,118,105	Y725C	probably damaging	Het
Cep164	T	A	9: 45,768,578	Q1119L	probably damaging	Het
Cep85l	G	A	10: 53,348,618	P292S	probably damaging	Het
Cfap53	A	G	18: 74,329,505		probably null	Het
Cts8	C	A	13: 61,251,731	C138F	probably damaging	Het
Dis3l	C	A	9: 64,339,612	E54*	probably null	Het
Dnaja1	T	A	4: 40,732,853	D367E	probably benign	Het
Duoxa2	T	C	2: 122,299,174	I45T	probably damaging	Het
EU599041	C	T	7: 43,225,909		noncoding transcript	Het
Exoc5	T	C	14: 49,015,479	M561V	probably benign	Het
Fam184a	T	C	10: 53,638,194	I296V	probably damaging	Het
Fbxl18	C	T	5: 142,878,761	V686M	probably damaging	Het
Fryl	A	G	5: 73,064,975	S2088P	probably damaging	Het
Fus	G	A	7: 127,985,534		probably benign	Het
Gm38394	A	G	1: 133,658,079	S507P	probably damaging	Het
Gpr183	T	A	14: 121,954,315	I265L	probably benign	Het
Herc1	T	G	9: 66,439,901	L2013V	probably benign	Het
Ick	C	T	9: 78,131,487	T6M	probably benign	Het
Iqca	T	C	1: 90,081,344	K430R	probably benign	Het
Itpripl2	A	G	7: 118,491,277	C20R	probably damaging	Het
Kmt2c	C	A	5: 25,287,112	C852F	probably damaging	Het
Lamb1	A	T	12: 31,318,467	K1199*	probably null	Het
Lrba	A	G	3: 86,304,336	Y421C	probably damaging	Het
Lrig2	A	G	3: 104,468,598	L96P	probably benign	Het
Mcc	A	G	18: 44,812,078	F29S	possibly damaging	Het
Mlh1	T	C	9: 111,258,566		probably benign	Het
Mpp5	T	C	12: 78,819,371		probably benign	Het
Rbm33	A	G	5: 28,394,230	T867A	unknown	Het
Sdk1	T	A	5: 142,046,292	S1041T	probably benign	Het
Serpinb2	A	G	1: 107,523,964		probably null	Het
Serpinb9d	A	G	13: 33,203,047	N366S	possibly damaging	Het
Sf3b1	A	G	1: 55,007,633	S251P	probably benign	Het
Slc45a1	T	C	4: 150,638,251	Y392C	probably benign	Het
Tlr4	T	A	4: 66,839,983	C338S	possibly damaging	Het
Vnn1	A	T	10: 23,897,401	I109L	probably benign	Het
Wnk1	A	G	6: 119,948,567	V1312A	probably benign	Het
Zfp28	A	G	7: 6,394,498	H644R	probably damaging	Het
Zfp286	A	G	11: 62,780,461	V262A	probably damaging	Het
Zfp292	A	T	4: 34,807,962	M1694K	probably benign	Het

Other mutations in Trio

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00480:Trio	APN	15	27912743	splice site	probably benign
IGL01011:Trio	APN	15	27736489	missense	probably damaging	0.96
IGL01090:Trio	APN	15	27773007	missense	probably damaging	1.00
IGL01145:Trio	APN	15	27818167	splice site	probably benign
IGL01147:Trio	APN	15	27881320	missense	probably damaging	1.00
IGL01161:Trio	APN	15	27749781	missense	probably damaging	1.00
IGL01324:Trio	APN	15	27905323	missense	probably benign	0.42
IGL01352:Trio	APN	15	27901229	missense	probably benign	0.01
IGL01366:Trio	APN	15	27732868	missense	possibly damaging	0.76
IGL01443:Trio	APN	15	27838775	splice site	probably benign
IGL01454:Trio	APN	15	27832985	missense	probably benign	0.32
IGL01695:Trio	APN	15	27773001	missense	probably damaging	1.00
IGL01765:Trio	APN	15	27764026	missense	possibly damaging	0.85
IGL01860:Trio	APN	15	27846810	missense	probably damaging	1.00
IGL01879:Trio	APN	15	27741033	missense	probably benign	0.12
IGL01991:Trio	APN	15	27871274	missense	possibly damaging	0.95
IGL02106:Trio	APN	15	27744158	missense	possibly damaging	0.85
IGL02209:Trio	APN	15	27744053	missense	probably damaging	1.00
IGL02232:Trio	APN	15	27902561	missense	probably benign	0.24
IGL02304:Trio	APN	15	27735436	missense	probably damaging	0.96
IGL02504:Trio	APN	15	27847390	nonsense	probably null
IGL02508:Trio	APN	15	27818104	missense	possibly damaging	0.65
IGL02541:Trio	APN	15	27844930	splice site	probably benign
IGL02617:Trio	APN	15	27841849	splice site	probably benign
IGL02675:Trio	APN	15	27768039	unclassified	probably benign
IGL02817:Trio	APN	15	27902881	missense	probably benign	0.01
IGL02993:Trio	APN	15	27830239	splice site	probably benign
IGL03007:Trio	APN	15	27902742	missense	probably damaging	0.99
IGL03135:Trio	APN	15	27832011	splice site	probably benign
IGL03225:Trio	APN	15	27902695	missense	probably benign	0.30
R0063:Trio	UTSW	15	27881437	splice site	probably benign
R0063:Trio	UTSW	15	27881437	splice site	probably benign
R0302:Trio	UTSW	15	27902517	missense	probably damaging	1.00
R0505:Trio	UTSW	15	27767907	missense	probably benign	0.00
R0506:Trio	UTSW	15	27854963	missense	probably benign	0.12
R0564:Trio	UTSW	15	27805822	missense	probably damaging	1.00
R0659:Trio	UTSW	15	27831399	missense	probably damaging	0.97
R0882:Trio	UTSW	15	27732894	missense	probably damaging	1.00
R0939:Trio	UTSW	15	27741250	critical splice donor site	probably null
R1018:Trio	UTSW	15	27871171	missense	probably damaging	1.00
R1439:Trio	UTSW	15	27897914	missense	probably damaging	1.00
R1456:Trio	UTSW	15	27753804	splice site	probably benign
R1488:Trio	UTSW	15	27740967	missense	probably damaging	1.00
R1522:Trio	UTSW	15	27732640	missense	probably benign	0.28
R1531:Trio	UTSW	15	27832985	missense	probably benign	0.32
R1640:Trio	UTSW	15	27833044	missense	probably damaging	1.00
R1646:Trio	UTSW	15	27758347	missense	possibly damaging	0.91
R1682:Trio	UTSW	15	27744146	splice site	probably null
R1780:Trio	UTSW	15	27744038	missense	possibly damaging	0.93
R1791:Trio	UTSW	15	27841756	missense	probably damaging	1.00
R1803:Trio	UTSW	15	27748340	missense	probably benign
R1817:Trio	UTSW	15	27742495	nonsense	probably null
R1853:Trio	UTSW	15	27756536	missense	probably damaging	1.00
R1898:Trio	UTSW	15	27742380	missense	possibly damaging	0.52
R1937:Trio	UTSW	15	27833056	missense	probably damaging	1.00
R1938:Trio	UTSW	15	27732891	missense	probably damaging	0.98
R2025:Trio	UTSW	15	27744137	missense	probably damaging	0.99
R2025:Trio	UTSW	15	27773927	missense	probably damaging	1.00
R2050:Trio	UTSW	15	27851945	missense	possibly damaging	0.85
R2913:Trio	UTSW	15	27854912	missense	probably damaging	1.00
R3151:Trio	UTSW	15	27805776	missense	probably damaging	1.00
R3771:Trio	UTSW	15	27748091	missense	probably damaging	0.98
R3773:Trio	UTSW	15	27748091	missense	probably damaging	0.98
R3826:Trio	UTSW	15	27833070	missense	probably damaging	1.00
R4015:Trio	UTSW	15	27744101	missense	possibly damaging	0.71
R4359:Trio	UTSW	15	27749797	nonsense	probably null
R4370:Trio	UTSW	15	27748337	nonsense	probably null
R4547:Trio	UTSW	15	27818982	missense	possibly damaging	0.89
R4573:Trio	UTSW	15	27772998	small deletion	probably benign
R4620:Trio	UTSW	15	27871171	missense	probably damaging	1.00
R4735:Trio	UTSW	15	27752789	splice site	probably null
R4764:Trio	UTSW	15	27732538	nonsense	probably null
R4775:Trio	UTSW	15	27881342	nonsense	probably null
R4942:Trio	UTSW	15	27752725	missense	probably benign	0.21
R5004:Trio	UTSW	15	27755178	missense	probably damaging	1.00
R5149:Trio	UTSW	15	27754029	missense	possibly damaging	0.74
R5183:Trio	UTSW	15	27902600	missense	probably benign	0.00
R5186:Trio	UTSW	15	27897991	missense	probably damaging	0.97
R5268:Trio	UTSW	15	27748286	missense	probably benign	0.02
R5344:Trio	UTSW	15	27735532	missense	probably benign	0.12
R5407:Trio	UTSW	15	27844806	splice site	probably null
R5442:Trio	UTSW	15	27856194	missense	probably benign	0.04
R5617:Trio	UTSW	15	27902748	missense	probably benign
R5778:Trio	UTSW	15	27856164	missense	probably benign	0.33
R5986:Trio	UTSW	15	27851933	missense	possibly damaging	0.88
R5990:Trio	UTSW	15	27891459	missense	probably benign	0.10
R6011:Trio	UTSW	15	27735545	missense	probably damaging	0.98
R6063:Trio	UTSW	15	27891379	missense	possibly damaging	0.94
R6166:Trio	UTSW	15	27818071	missense	probably damaging	0.96
R6187:Trio	UTSW	15	27743952	critical splice donor site	probably null
R6387:Trio	UTSW	15	27752739	missense	probably damaging	1.00
R6402:Trio	UTSW	15	27902911	missense	probably benign	0.02
R6478:Trio	UTSW	15	27856107	missense	probably benign	0.01
R6528:Trio	UTSW	15	27805870	missense	probably damaging	1.00
R6662:Trio	UTSW	15	27854996	missense	probably benign	0.00
R6825:Trio	UTSW	15	27889308	missense	probably damaging	0.98
R6890:Trio	UTSW	15	27919288	unclassified	probably benign
R6945:Trio	UTSW	15	27824090	missense	probably damaging	1.00
R7027:Trio	UTSW	15	27805654	missense	possibly damaging	0.86
R7046:Trio	UTSW	15	27832051	missense	probably damaging	1.00
R7049:Trio	UTSW	15	27749799	missense	possibly damaging	0.66
R7075:Trio	UTSW	15	27898000	missense	unknown
R7094:Trio	UTSW	15	27891448	missense	unknown
R7123:Trio	UTSW	15	27742313	critical splice donor site	probably benign
R7130:Trio	UTSW	15	27742313	critical splice donor site	probably benign
R7214:Trio	UTSW	15	27871187	missense	probably damaging	0.97
R7292:Trio	UTSW	15	27828351	missense	possibly damaging	0.63
R7293:Trio	UTSW	15	27871289	missense	possibly damaging	0.66
R7352:Trio	UTSW	15	27732876	missense	probably damaging	0.96
R7426:Trio	UTSW	15	27856107	missense	probably benign	0.01
R7451:Trio	UTSW	15	27747913	missense	probably benign	0.07
R7558:Trio	UTSW	15	27831394	missense	possibly damaging	0.90
R7578:Trio	UTSW	15	27854939	missense	possibly damaging	0.94
R7596:Trio	UTSW	15	27749826	missense	probably damaging	0.99
R7604:Trio	UTSW	15	27736445	critical splice donor site	probably null
R7609:Trio	UTSW	15	27912642	missense	unknown
R7767:Trio	UTSW	15	27889418	missense	unknown
R7784:Trio	UTSW	15	27763994	missense	probably damaging	1.00
R7817:Trio	UTSW	15	27749866	missense	probably benign	0.35
R7833:Trio	UTSW	15	27774086	missense	probably damaging	0.99
R7873:Trio	UTSW	15	27805684	missense	possibly damaging	0.83
R7879:Trio	UTSW	15	27851924	missense	possibly damaging	0.94
R7989:Trio	UTSW	15	27772935	missense	probably damaging	0.97
R8022:Trio	UTSW	15	27749866	missense	probably benign	0.35
R8050:Trio	UTSW	15	27891454	missense	unknown
R8217:Trio	UTSW	15	27818969	missense	probably damaging	0.97
R8280:Trio	UTSW	15	27902910	missense	unknown
R8283:Trio	UTSW	15	27756542	missense	possibly damaging	0.79
R8300:Trio	UTSW	15	27855022	missense	possibly damaging	0.66
R8321:Trio	UTSW	15	27881326	missense	possibly damaging	0.90
R8477:Trio	UTSW	15	27773952	missense	possibly damaging	0.83
R8479:Trio	UTSW	15	27901200	missense	probably benign	0.25
X0024:Trio	UTSW	15	27765726	missense	possibly damaging	0.91
Z1176:Trio	UTSW	15	27771387	missense	probably benign	0.00

Predicted Primers

PCR Primer
(F):5'- TGGGCTCTAAGAACAGAATCCC -3'
(R):5'- TTGCAGGGTTTGACGAAAAC -3'

Sequencing Primer
(F):5'- CAAGAGTATCAGTGTGCCCTCTAG -3'
(R):5'- CATTGAGTCTCAGGGAGAGCTCATC -3'

Posted On

2014-10-02