Incidental Mutation 'R2186:Mcc'
ID237794
Institutional Source Beutler Lab
Gene Symbol Mcc
Ensembl Gene ENSMUSG00000071856
Gene Namemutated in colorectal cancers
SynonymsD18Ertd451e
MMRRC Submission 040188-MU
Accession Numbers

Ncbi RefSeq: NM_001085373.1, NM_001085374.1; MGI:96930

Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R2186 (G1)
Quality Score173
Status Validated
Chromosome18
Chromosomal Location44425060-44812182 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 44812078 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Serine at position 29 (F29S)
Ref Sequence ENSEMBL: ENSMUSP00000087318 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000089874]
Predicted Effect possibly damaging
Transcript: ENSMUST00000089874
AA Change: F29S

PolyPhen 2 Score 0.711 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000087318
Gene: ENSMUSG00000071856
AA Change: F29S

DomainStartEndE-ValueType
low complexity region 9 23 N/A INTRINSIC
EFh 24 52 1.36e-3 SMART
EFh 57 85 7.36e0 SMART
coiled coil region 196 308 N/A INTRINSIC
coiled coil region 395 466 N/A INTRINSIC
low complexity region 488 493 N/A INTRINSIC
low complexity region 512 517 N/A INTRINSIC
low complexity region 523 537 N/A INTRINSIC
Pfam:MCC-bdg_PDZ 577 641 2.6e-32 PFAM
low complexity region 715 731 N/A INTRINSIC
coiled coil region 738 834 N/A INTRINSIC
low complexity region 853 863 N/A INTRINSIC
Pfam:MCC-bdg_PDZ 906 972 1.1e-21 PFAM
Meta Mutation Damage Score 0.2270 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.4%
Validation Efficiency 100% (51/51)
MGI Phenotype Strain: 3889488; 4335844
FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a candidate colorectal tumor suppressor gene that is thought to negatively regulate cell cycle progression. The orthologous gene in the mouse expresses a phosphoprotein associated with the plasma membrane and membrane organelles, and overexpression of the mouse protein inhibits entry into S phase. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for hypomorphic or null mutations are viable and fertile with no gross abnormalities. [provided by MGI curators]
Allele List at MGI

All alleles(29) : Targeted(2) Gene trapped(27)

Other mutations in this stock
Total: 46 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310033P09Rik A G 11: 59,208,514 N29S probably damaging Het
4931409K22Rik C T 5: 24,554,526 G82E probably damaging Het
Ap1b1 T C 11: 5,015,737 V92A possibly damaging Het
Asgr1 G A 11: 70,056,249 R66Q probably benign Het
Atp8b4 T A 2: 126,358,860 Q796L probably damaging Het
Camk4 A C 18: 33,182,341 D307A probably damaging Het
Catsperb T A 12: 101,480,782 I223K probably benign Het
Ccdc80 A G 16: 45,118,105 Y725C probably damaging Het
Cep164 T A 9: 45,768,578 Q1119L probably damaging Het
Cep85l G A 10: 53,348,618 P292S probably damaging Het
Cfap53 A G 18: 74,329,505 probably null Het
Cts8 C A 13: 61,251,731 C138F probably damaging Het
Dis3l C A 9: 64,339,612 E54* probably null Het
Dnaja1 T A 4: 40,732,853 D367E probably benign Het
Duoxa2 T C 2: 122,299,174 I45T probably damaging Het
EU599041 C T 7: 43,225,909 noncoding transcript Het
Exoc5 T C 14: 49,015,479 M561V probably benign Het
Fam184a T C 10: 53,638,194 I296V probably damaging Het
Fbxl18 C T 5: 142,878,761 V686M probably damaging Het
Fryl A G 5: 73,064,975 S2088P probably damaging Het
Fus G A 7: 127,985,534 probably benign Het
Gm38394 A G 1: 133,658,079 S507P probably damaging Het
Gpr183 T A 14: 121,954,315 I265L probably benign Het
Herc1 T G 9: 66,439,901 L2013V probably benign Het
Ick C T 9: 78,131,487 T6M probably benign Het
Iqca T C 1: 90,081,344 K430R probably benign Het
Itpripl2 A G 7: 118,491,277 C20R probably damaging Het
Kmt2c C A 5: 25,287,112 C852F probably damaging Het
Lamb1 A T 12: 31,318,467 K1199* probably null Het
Lrba A G 3: 86,304,336 Y421C probably damaging Het
Lrig2 A G 3: 104,468,598 L96P probably benign Het
Mlh1 T C 9: 111,258,566 probably benign Het
Mpp5 T C 12: 78,819,371 probably benign Het
Rbm33 A G 5: 28,394,230 T867A unknown Het
Sdk1 T A 5: 142,046,292 S1041T probably benign Het
Serpinb2 A G 1: 107,523,964 probably null Het
Serpinb9d A G 13: 33,203,047 N366S possibly damaging Het
Sf3b1 A G 1: 55,007,633 S251P probably benign Het
Slc45a1 T C 4: 150,638,251 Y392C probably benign Het
Tlr4 T A 4: 66,839,983 C338S possibly damaging Het
Trio A G 15: 27,823,975 probably null Het
Vnn1 A T 10: 23,897,401 I109L probably benign Het
Wnk1 A G 6: 119,948,567 V1312A probably benign Het
Zfp28 A G 7: 6,394,498 H644R probably damaging Het
Zfp286 A G 11: 62,780,461 V262A probably damaging Het
Zfp292 A T 4: 34,807,962 M1694K probably benign Het
Other mutations in Mcc
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00489:Mcc APN 18 44449216 missense possibly damaging 0.93
IGL00981:Mcc APN 18 44449349 missense probably damaging 0.99
IGL00985:Mcc APN 18 44491239 missense probably damaging 1.00
IGL01674:Mcc APN 18 44491156 missense probably benign 0.10
IGL01862:Mcc APN 18 44759296 missense probably benign 0.00
IGL01935:Mcc APN 18 44519516 critical splice donor site probably null
IGL02168:Mcc APN 18 44449299 missense probably damaging 0.97
IGL02449:Mcc APN 18 44459958 missense probably benign 0.10
IGL02613:Mcc APN 18 44429954 missense probably damaging 1.00
IGL02709:Mcc APN 18 44445810 missense possibly damaging 0.73
R0009:Mcc UTSW 18 44445933 missense probably damaging 1.00
R0009:Mcc UTSW 18 44445933 missense probably damaging 1.00
R0021:Mcc UTSW 18 44519516 critical splice donor site probably benign
R0022:Mcc UTSW 18 44519516 critical splice donor site probably benign
R0062:Mcc UTSW 18 44519516 critical splice donor site probably benign
R0062:Mcc UTSW 18 44519516 critical splice donor site probably benign
R0063:Mcc UTSW 18 44519516 critical splice donor site probably benign
R0064:Mcc UTSW 18 44519516 critical splice donor site probably benign
R0217:Mcc UTSW 18 44519516 critical splice donor site probably benign
R0218:Mcc UTSW 18 44519516 critical splice donor site probably benign
R0243:Mcc UTSW 18 44759299 missense probably benign
R0373:Mcc UTSW 18 44475222 missense probably benign 0.01
R0564:Mcc UTSW 18 44468507 missense probably damaging 1.00
R0604:Mcc UTSW 18 44473756 missense probably damaging 1.00
R0691:Mcc UTSW 18 44445860 missense possibly damaging 0.67
R0965:Mcc UTSW 18 44724526 missense probably benign 0.41
R1015:Mcc UTSW 18 44724669 missense probably benign
R1186:Mcc UTSW 18 44759403 missense probably benign
R1215:Mcc UTSW 18 44468494 missense possibly damaging 0.93
R1878:Mcc UTSW 18 44468400 missense possibly damaging 0.69
R1990:Mcc UTSW 18 44491315 nonsense probably null
R1991:Mcc UTSW 18 44491315 nonsense probably null
R1992:Mcc UTSW 18 44491315 nonsense probably null
R2189:Mcc UTSW 18 44534230 missense possibly damaging 0.93
R2258:Mcc UTSW 18 44475136 missense probably damaging 1.00
R2267:Mcc UTSW 18 44519541 missense probably damaging 0.99
R2310:Mcc UTSW 18 44431366 missense probably damaging 1.00
R2343:Mcc UTSW 18 44459797 critical splice donor site probably null
R2377:Mcc UTSW 18 44519549 missense probably damaging 1.00
R3110:Mcc UTSW 18 44449263 missense probably damaging 1.00
R3112:Mcc UTSW 18 44449263 missense probably damaging 1.00
R4135:Mcc UTSW 18 44724640 missense probably benign 0.03
R4404:Mcc UTSW 18 44759298 missense probably benign
R4600:Mcc UTSW 18 44519520 missense probably damaging 1.00
R4606:Mcc UTSW 18 44468421 missense probably damaging 0.96
R4721:Mcc UTSW 18 44519556 missense probably damaging 1.00
R5858:Mcc UTSW 18 44510141 missense probably damaging 0.98
R5997:Mcc UTSW 18 44449321 missense probably damaging 1.00
R6482:Mcc UTSW 18 44445864 missense possibly damaging 0.94
R6502:Mcc UTSW 18 44468390 nonsense probably null
R6502:Mcc UTSW 18 44468391 missense probably damaging 1.00
R6518:Mcc UTSW 18 44661811 start gained probably benign
R6796:Mcc UTSW 18 44724560 missense probably benign
R6846:Mcc UTSW 18 44473640 missense possibly damaging 0.63
R6879:Mcc UTSW 18 44812112 missense unknown
R7147:Mcc UTSW 18 44493513 missense probably damaging 0.99
R7475:Mcc UTSW 18 44476236 missense probably damaging 0.98
R7515:Mcc UTSW 18 44493432 missense probably benign 0.02
R7608:Mcc UTSW 18 44491227 missense possibly damaging 0.83
X0010:Mcc UTSW 18 44429957 missense possibly damaging 0.94
Predicted Primers PCR Primer
(F):5'- AGAGCAGAGCCTTCTACCTG -3'
(R):5'- CTTTGGCTTTCAGGTAGGCATC -3'

Sequencing Primer
(F):5'- AGAGCCTTCTACCTGGGACC -3'
(R):5'- TTTCAGGTAGGCATCCCAGAC -3'
Posted On2014-10-02