Mutagenetix > Incidental Mutations

Incidental Mutation 'R2186:Mcc'

237794

Institutional Source

Beutler Lab

Gene Symbol

Mcc

Ensembl Gene

ENSMUSG00000071856

Gene Name

mutated in colorectal cancers

Synonyms

D18Ertd451e

MMRRC Submission

040188-MU

Accession Numbers

Ncbi RefSeq: NM_001085373.1, NM_001085374.1; MGI:96930

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R2186 (G1)

Quality Score

173

Status

Validated

Chromosome

Chromosomal Location

44425060-44812182 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 44812078 bp

Zygosity

Heterozygous

Amino Acid Change

Phenylalanine to Serine at position 29 (F29S)

Ref Sequence

ENSEMBL: ENSMUSP00000087318 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000089874]

Predicted Effect

possibly damaging
Transcript: ENSMUST00000089874
AA Change: F29S

PolyPhen 2 Score 0.711 (Sensitivity: 0.86; Specificity: 0.92)

SMART Domains

Protein: ENSMUSP00000087318
Gene: ENSMUSG00000071856
AA Change: F29S

Domain	Start	End	E-Value	Type
low complexity region	9	23	N/A	INTRINSIC
EFh	24	52	1.36e-3	SMART
EFh	57	85	7.36e0	SMART
coiled coil region	196	308	N/A	INTRINSIC
coiled coil region	395	466	N/A	INTRINSIC
low complexity region	488	493	N/A	INTRINSIC
low complexity region	512	517	N/A	INTRINSIC
low complexity region	523	537	N/A	INTRINSIC
Pfam:MCC-bdg_PDZ	577	641	2.6e-32	PFAM
low complexity region	715	731	N/A	INTRINSIC
coiled coil region	738	834	N/A	INTRINSIC
low complexity region	853	863	N/A	INTRINSIC
Pfam:MCC-bdg_PDZ	906	972	1.1e-21	PFAM

Meta Mutation Damage Score

0.2270

Coding Region Coverage

1x: 99.2%
3x: 98.6%
10x: 97.4%
20x: 95.4%

Validation Efficiency

100% (51/51)

MGI Phenotype

Strain: 3889488; 4335844
FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a candidate colorectal tumor suppressor gene that is thought to negatively regulate cell cycle progression. The orthologous gene in the mouse expresses a phosphoprotein associated with the plasma membrane and membrane organelles, and overexpression of the mouse protein inhibits entry into S phase. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for hypomorphic or null mutations are viable and fertile with no gross abnormalities. [provided by MGI curators]

Allele List at MGI

All alleles(29) : Targeted(2) Gene trapped(27)

Other mutations in this stock

Total: 46 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2310033P09Rik	A	G	11: 59,208,514	N29S	probably damaging	Het
4931409K22Rik	C	T	5: 24,554,526	G82E	probably damaging	Het
Ap1b1	T	C	11: 5,015,737	V92A	possibly damaging	Het
Asgr1	G	A	11: 70,056,249	R66Q	probably benign	Het
Atp8b4	T	A	2: 126,358,860	Q796L	probably damaging	Het
Camk4	A	C	18: 33,182,341	D307A	probably damaging	Het
Catsperb	T	A	12: 101,480,782	I223K	probably benign	Het
Ccdc80	A	G	16: 45,118,105	Y725C	probably damaging	Het
Cep164	T	A	9: 45,768,578	Q1119L	probably damaging	Het
Cep85l	G	A	10: 53,348,618	P292S	probably damaging	Het
Cfap53	A	G	18: 74,329,505		probably null	Het
Cts8	C	A	13: 61,251,731	C138F	probably damaging	Het
Dis3l	C	A	9: 64,339,612	E54*	probably null	Het
Dnaja1	T	A	4: 40,732,853	D367E	probably benign	Het
Duoxa2	T	C	2: 122,299,174	I45T	probably damaging	Het
EU599041	C	T	7: 43,225,909		noncoding transcript	Het
Exoc5	T	C	14: 49,015,479	M561V	probably benign	Het
Fam184a	T	C	10: 53,638,194	I296V	probably damaging	Het
Fbxl18	C	T	5: 142,878,761	V686M	probably damaging	Het
Fryl	A	G	5: 73,064,975	S2088P	probably damaging	Het
Fus	G	A	7: 127,985,534		probably benign	Het
Gm38394	A	G	1: 133,658,079	S507P	probably damaging	Het
Gpr183	T	A	14: 121,954,315	I265L	probably benign	Het
Herc1	T	G	9: 66,439,901	L2013V	probably benign	Het
Ick	C	T	9: 78,131,487	T6M	probably benign	Het
Iqca	T	C	1: 90,081,344	K430R	probably benign	Het
Itpripl2	A	G	7: 118,491,277	C20R	probably damaging	Het
Kmt2c	C	A	5: 25,287,112	C852F	probably damaging	Het
Lamb1	A	T	12: 31,318,467	K1199*	probably null	Het
Lrba	A	G	3: 86,304,336	Y421C	probably damaging	Het
Lrig2	A	G	3: 104,468,598	L96P	probably benign	Het
Mlh1	T	C	9: 111,258,566		probably benign	Het
Mpp5	T	C	12: 78,819,371		probably benign	Het
Rbm33	A	G	5: 28,394,230	T867A	unknown	Het
Sdk1	T	A	5: 142,046,292	S1041T	probably benign	Het
Serpinb2	A	G	1: 107,523,964		probably null	Het
Serpinb9d	A	G	13: 33,203,047	N366S	possibly damaging	Het
Sf3b1	A	G	1: 55,007,633	S251P	probably benign	Het
Slc45a1	T	C	4: 150,638,251	Y392C	probably benign	Het
Tlr4	T	A	4: 66,839,983	C338S	possibly damaging	Het
Trio	A	G	15: 27,823,975		probably null	Het
Vnn1	A	T	10: 23,897,401	I109L	probably benign	Het
Wnk1	A	G	6: 119,948,567	V1312A	probably benign	Het
Zfp28	A	G	7: 6,394,498	H644R	probably damaging	Het
Zfp286	A	G	11: 62,780,461	V262A	probably damaging	Het
Zfp292	A	T	4: 34,807,962	M1694K	probably benign	Het

Other mutations in Mcc

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00489:Mcc	APN	18	44449216	missense	possibly damaging	0.93
IGL00981:Mcc	APN	18	44449349	missense	probably damaging	0.99
IGL00985:Mcc	APN	18	44491239	missense	probably damaging	1.00
IGL01674:Mcc	APN	18	44491156	missense	probably benign	0.10
IGL01862:Mcc	APN	18	44759296	missense	probably benign	0.00
IGL01935:Mcc	APN	18	44519516	critical splice donor site	probably null
IGL02168:Mcc	APN	18	44449299	missense	probably damaging	0.97
IGL02449:Mcc	APN	18	44459958	missense	probably benign	0.10
IGL02613:Mcc	APN	18	44429954	missense	probably damaging	1.00
IGL02709:Mcc	APN	18	44445810	missense	possibly damaging	0.73
R0009:Mcc	UTSW	18	44445933	missense	probably damaging	1.00
R0009:Mcc	UTSW	18	44445933	missense	probably damaging	1.00
R0021:Mcc	UTSW	18	44519516	critical splice donor site	probably benign
R0022:Mcc	UTSW	18	44519516	critical splice donor site	probably benign
R0062:Mcc	UTSW	18	44519516	critical splice donor site	probably benign
R0062:Mcc	UTSW	18	44519516	critical splice donor site	probably benign
R0063:Mcc	UTSW	18	44519516	critical splice donor site	probably benign
R0064:Mcc	UTSW	18	44519516	critical splice donor site	probably benign
R0217:Mcc	UTSW	18	44519516	critical splice donor site	probably benign
R0218:Mcc	UTSW	18	44519516	critical splice donor site	probably benign
R0243:Mcc	UTSW	18	44759299	missense	probably benign
R0373:Mcc	UTSW	18	44475222	missense	probably benign	0.01
R0564:Mcc	UTSW	18	44468507	missense	probably damaging	1.00
R0604:Mcc	UTSW	18	44473756	missense	probably damaging	1.00
R0691:Mcc	UTSW	18	44445860	missense	possibly damaging	0.67
R0965:Mcc	UTSW	18	44724526	missense	probably benign	0.41
R1015:Mcc	UTSW	18	44724669	missense	probably benign
R1186:Mcc	UTSW	18	44759403	missense	probably benign
R1215:Mcc	UTSW	18	44468494	missense	possibly damaging	0.93
R1878:Mcc	UTSW	18	44468400	missense	possibly damaging	0.69
R1990:Mcc	UTSW	18	44491315	nonsense	probably null
R1991:Mcc	UTSW	18	44491315	nonsense	probably null
R1992:Mcc	UTSW	18	44491315	nonsense	probably null
R2189:Mcc	UTSW	18	44534230	missense	possibly damaging	0.93
R2258:Mcc	UTSW	18	44475136	missense	probably damaging	1.00
R2267:Mcc	UTSW	18	44519541	missense	probably damaging	0.99
R2310:Mcc	UTSW	18	44431366	missense	probably damaging	1.00
R2343:Mcc	UTSW	18	44459797	critical splice donor site	probably null
R2377:Mcc	UTSW	18	44519549	missense	probably damaging	1.00
R3110:Mcc	UTSW	18	44449263	missense	probably damaging	1.00
R3112:Mcc	UTSW	18	44449263	missense	probably damaging	1.00
R4135:Mcc	UTSW	18	44724640	missense	probably benign	0.03
R4404:Mcc	UTSW	18	44759298	missense	probably benign
R4600:Mcc	UTSW	18	44519520	missense	probably damaging	1.00
R4606:Mcc	UTSW	18	44468421	missense	probably damaging	0.96
R4721:Mcc	UTSW	18	44519556	missense	probably damaging	1.00
R5858:Mcc	UTSW	18	44510141	missense	probably damaging	0.98
R5997:Mcc	UTSW	18	44449321	missense	probably damaging	1.00
R6482:Mcc	UTSW	18	44445864	missense	possibly damaging	0.94
R6502:Mcc	UTSW	18	44468390	nonsense	probably null
R6502:Mcc	UTSW	18	44468391	missense	probably damaging	1.00
R6518:Mcc	UTSW	18	44661811	start gained	probably benign
R6796:Mcc	UTSW	18	44724560	missense	probably benign
R6846:Mcc	UTSW	18	44473640	missense	possibly damaging	0.63
R6879:Mcc	UTSW	18	44812112	missense	unknown
R7147:Mcc	UTSW	18	44493513	missense	probably damaging	0.99
R7475:Mcc	UTSW	18	44476236	missense	probably damaging	0.98
R7515:Mcc	UTSW	18	44493432	missense	probably benign	0.02
R7608:Mcc	UTSW	18	44491227	missense	possibly damaging	0.83
R8092:Mcc	UTSW	18	44759232	missense	probably benign	0.00
R8119:Mcc	UTSW	18	44468433	missense	possibly damaging	0.95
R8162:Mcc	UTSW	18	44449441	critical splice acceptor site	probably null
R8187:Mcc	UTSW	18	44534260	missense	possibly damaging	0.53
X0010:Mcc	UTSW	18	44429957	missense	possibly damaging	0.94
Z1177:Mcc	UTSW	18	44491246	missense	probably benign	0.04

Predicted Primers

PCR Primer
(F):5'- AGAGCAGAGCCTTCTACCTG -3'
(R):5'- CTTTGGCTTTCAGGTAGGCATC -3'

Sequencing Primer
(F):5'- AGAGCCTTCTACCTGGGACC -3'
(R):5'- TTTCAGGTAGGCATCCCAGAC -3'

Posted On

2014-10-02