Incidental Mutation 'R2185:Gm8251'
ID237796
Institutional Source Beutler Lab
Gene Symbol Gm8251
Ensembl Gene ENSMUSG00000091844
Gene Namepredicted gene 8251
Synonyms
MMRRC Submission 040187-MU
Accession Numbers

Genbank: XM_985572; MGI: 3647616

Is this an essential gene? Probably non essential (E-score: 0.123) question?
Stock #R2185 (G1)
Quality Score225
Status Validated
Chromosome1
Chromosomal Location44055952-44061936 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 44061381 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Tyrosine at position 186 (H186Y)
Ref Sequence ENSEMBL: ENSMUSP00000127017 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000168641]
Predicted Effect probably benign
Transcript: ENSMUST00000168641
AA Change: H186Y

PolyPhen 2 Score 0.006 (Sensitivity: 0.97; Specificity: 0.75)
SMART Domains Protein: ENSMUSP00000127017
Gene: ENSMUSG00000091844
AA Change: H186Y

DomainStartEndE-ValueType
Pfam:CCDC168_N 2 202 2.5e-83 PFAM
Pfam:CCDC168_N 200 302 1.7e-26 PFAM
Pfam:CCDC168_N 347 397 2.1e-4 PFAM
Pfam:CCDC168_N 437 581 8.5e-8 PFAM
Pfam:CCDC168_N 663 802 6.3e-5 PFAM
Pfam:CCDC168_N 788 955 1e-9 PFAM
low complexity region 1803 1819 N/A INTRINSIC
low complexity region 1830 1847 N/A INTRINSIC
low complexity region 1968 1984 N/A INTRINSIC
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.6%
  • 20x: 96.0%
Validation Efficiency 100% (48/48)
Allele List at MGI
Other mutations in this stock
Total: 49 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700123K08Rik T C 5: 138,563,567 D119G probably damaging Het
Abca1 A G 4: 53,089,830 M427T probably benign Het
Ankra2 T C 13: 98,266,404 F53S probably damaging Het
Ano3 T C 2: 110,775,045 E272G probably benign Het
Aqr C T 2: 114,130,534 probably null Het
Clca4b T C 3: 144,928,556 Y92C probably damaging Het
Crebbp A T 16: 4,084,138 N2374K probably damaging Het
Cspg4 A T 9: 56,886,972 I664L probably benign Het
Ctnnd1 A T 2: 84,612,548 D626E probably damaging Het
Eml2 A G 7: 19,194,028 Y254C probably damaging Het
Fam92a A T 4: 12,169,041 probably benign Het
Gabrr3 T C 16: 59,434,668 S239P probably damaging Het
Gen1 T C 12: 11,261,040 T64A probably null Het
Gm14399 C A 2: 175,131,395 C189F probably damaging Het
Gm9476 T G 10: 100,307,178 noncoding transcript Het
Kcnh5 A T 12: 75,130,931 F134I possibly damaging Het
Kdm4b G C 17: 56,393,750 A474P probably benign Het
Kif2b TTCTCTCTCT TTCTCTCT 11: 91,576,971 probably null Het
Klk14 G A 7: 43,692,077 C51Y probably damaging Het
Lrrc28 C T 7: 67,545,453 R203Q possibly damaging Het
Lrrc8e G T 8: 4,234,986 E404* probably null Het
Macf1 A T 4: 123,475,556 M239K probably damaging Het
Mamdc4 A G 2: 25,569,692 probably null Het
Matr3 A G 18: 35,581,225 Y75C probably damaging Het
Myo19 T C 11: 84,892,221 V187A probably benign Het
Ncbp2 A G 16: 31,956,377 D116G probably damaging Het
Olfr1012 T C 2: 85,760,019 Y119C probably damaging Het
Olfr1208 A C 2: 88,896,703 V298G probably damaging Het
Olfr412 A T 11: 74,364,746 I26F probably benign Het
Olfr679 T A 7: 105,086,302 D195E possibly damaging Het
Pkd1l3 T A 8: 109,633,195 M894K possibly damaging Het
Prpf8 C T 11: 75,487,113 R8* probably null Het
Prss12 T A 3: 123,487,144 S493T probably benign Het
Ptov1 T G 7: 44,867,283 probably benign Het
Rfpl4 A T 7: 5,115,500 L24M probably damaging Het
Rundc1 C A 11: 101,425,331 D76E probably benign Het
Slc5a11 G T 7: 123,273,198 A673S probably damaging Het
Smg5 T C 3: 88,351,561 M613T probably benign Het
Swt1 T A 1: 151,384,468 H677L probably damaging Het
Tas2r107 T C 6: 131,659,603 N161S probably damaging Het
Trp73 A T 4: 154,104,817 probably null Het
Tsr1 A G 11: 74,902,080 I405V probably damaging Het
Ttll4 A G 1: 74,679,829 T280A possibly damaging Het
Ube2q2 A G 9: 55,195,082 probably null Het
Usp5 T C 6: 124,817,410 E769G probably damaging Het
Vmn2r68 T A 7: 85,233,693 K284* probably null Het
Wdr63 A G 3: 146,066,864 S476P possibly damaging Het
Zfp963 C A 8: 69,742,911 K297N probably benign Het
Zfp975 C A 7: 42,661,681 A503S possibly damaging Het
Other mutations in Gm8251
AlleleSourceChrCoordTypePredicted EffectPPH Score
D3080:Gm8251 UTSW 1 44067335
R0045:Gm8251 UTSW 1 44057205 missense probably benign
R0110:Gm8251 UTSW 1 44059224 missense probably benign
R0450:Gm8251 UTSW 1 44061097 missense possibly damaging 0.85
R0469:Gm8251 UTSW 1 44061097 missense possibly damaging 0.85
R0510:Gm8251 UTSW 1 44061097 missense possibly damaging 0.85
R0602:Gm8251 UTSW 1 44059967 missense possibly damaging 0.96
R0648:Gm8251 UTSW 1 44056563 missense possibly damaging 0.73
R0928:Gm8251 UTSW 1 44057228 missense possibly damaging 0.73
R1056:Gm8251 UTSW 1 44060927 missense probably damaging 1.00
R1217:Gm8251 UTSW 1 44057179 missense possibly damaging 0.73
R1232:Gm8251 UTSW 1 44056592 missense possibly damaging 0.96
R1399:Gm8251 UTSW 1 44061311 missense possibly damaging 0.93
R1489:Gm8251 UTSW 1 44057790 missense probably benign 0.18
R1489:Gm8251 UTSW 1 44061507 missense probably benign 0.06
R1519:Gm8251 UTSW 1 44056970 missense probably benign 0.33
R1664:Gm8251 UTSW 1 44059227 missense possibly damaging 0.71
R1828:Gm8251 UTSW 1 44057074 missense possibly damaging 0.72
R1944:Gm8251 UTSW 1 44061849 missense probably damaging 0.97
R2032:Gm8251 UTSW 1 44061740 missense possibly damaging 0.86
R2094:Gm8251 UTSW 1 44059730 missense probably benign 0.06
R2170:Gm8251 UTSW 1 44056008 missense probably benign 0.18
R2280:Gm8251 UTSW 1 44056460 missense possibly damaging 0.53
R2281:Gm8251 UTSW 1 44056460 missense possibly damaging 0.53
R2339:Gm8251 UTSW 1 44060863 missense probably benign
R3617:Gm8251 UTSW 1 44060954 missense probably benign
R3738:Gm8251 UTSW 1 44058866 missense probably benign 0.33
R4012:Gm8251 UTSW 1 44060969 missense possibly damaging 0.85
R4034:Gm8251 UTSW 1 44058866 missense probably benign 0.33
R4344:Gm8251 UTSW 1 44060991 missense possibly damaging 0.86
R4436:Gm8251 UTSW 1 44056116 missense probably benign 0.03
R4485:Gm8251 UTSW 1 44060123 missense probably benign
R4735:Gm8251 UTSW 1 44061701 missense probably benign
R4782:Gm8251 UTSW 1 44059043 missense possibly damaging 0.85
R4837:Gm8251 UTSW 1 44061434 missense possibly damaging 0.93
R4862:Gm8251 UTSW 1 44058018 missense possibly damaging 0.93
R5247:Gm8251 UTSW 1 44057006 nonsense probably null
R5347:Gm8251 UTSW 1 44057795 missense probably benign 0.01
R5355:Gm8251 UTSW 1 44057979 missense possibly damaging 0.53
R5559:Gm8251 UTSW 1 44058515 missense possibly damaging 0.77
R5640:Gm8251 UTSW 1 44061927 missense probably benign 0.00
R5681:Gm8251 UTSW 1 44061464 missense possibly damaging 0.93
R5776:Gm8251 UTSW 1 44056505 missense possibly damaging 0.72
R5919:Gm8251 UTSW 1 44056986 missense probably benign
R5987:Gm8251 UTSW 1 44057257 missense probably benign
R6616:Gm8251 UTSW 1 44061474 missense possibly damaging 0.51
R6677:Gm8251 UTSW 1 44058699 missense probably benign 0.00
R6830:Gm8251 UTSW 1 44056730 missense probably benign 0.33
R6906:Gm8251 UTSW 1 44056013 missense probably benign 0.33
R6909:Gm8251 UTSW 1 44059775 missense possibly damaging 0.71
R6957:Gm8251 UTSW 1 44057207 missense probably benign 0.00
R7008:Gm8251 UTSW 1 44059625 missense probably benign
R7052:Gm8251 UTSW 1 44057306 missense possibly damaging 0.53
R7176:Gm8251 UTSW 1 44060346 missense probably benign 0.00
R7190:Gm8251 UTSW 1 44061615 missense probably benign 0.32
R7296:Gm8251 UTSW 1 44060916 nonsense probably null
R7347:Gm8251 UTSW 1 44059496 missense probably damaging 0.99
R7371:Gm8251 UTSW 1 44061377 missense probably benign
R7375:Gm8251 UTSW 1 44060534 missense possibly damaging 0.53
R7442:Gm8251 UTSW 1 44058708 missense possibly damaging 0.84
R7450:Gm8251 UTSW 1 44058773 missense probably benign 0.33
R7574:Gm8251 UTSW 1 44059433 missense possibly damaging 0.93
R7586:Gm8251 UTSW 1 44060013 missense probably benign 0.20
R7739:Gm8251 UTSW 1 44056418 missense possibly damaging 0.86
R7878:Gm8251 UTSW 1 44056014 missense probably benign 0.18
R7959:Gm8251 UTSW 1 44057568 missense probably benign
R7991:Gm8251 UTSW 1 44059709 missense probably benign 0.00
R8035:Gm8251 UTSW 1 44061551 missense possibly damaging 0.51
R8281:Gm8251 UTSW 1 44056538 missense possibly damaging 0.93
YA93:Gm8251 UTSW 1 44065085 unclassified probably benign
Predicted Primers PCR Primer
(F):5'- TACTGTGCTCGCTGAGACTG -3'
(R):5'- GAAGTACAAACCTCAGCCATTG -3'

Sequencing Primer
(F):5'- GCTCGCTGAGACTGAACACATG -3'
(R):5'- GAGAATTTGACTTACCTCAGAGGCC -3'
Posted On2014-10-02