Incidental Mutation 'R2185:Mamdc4'
ID237800
Institutional Source Beutler Lab
Gene Symbol Mamdc4
Ensembl Gene ENSMUSG00000026941
Gene NameMAM domain containing 4
SynonymsLOC381352
MMRRC Submission 040187-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.079) question?
Stock #R2185 (G1)
Quality Score225
Status Validated
Chromosome2
Chromosomal Location25563115-25574845 bp(-) (GRCm38)
Type of Mutationcritical splice donor site (2 bp from exon)
DNA Base Change (assembly) A to G at 25569692 bp
ZygosityHeterozygous
Amino Acid Change
Gene Model predicted gene model for transcript(s): [ENSMUST00000039156] [ENSMUST00000095117] [ENSMUST00000095117] [ENSMUST00000114223] [ENSMUST00000114223]
Predicted Effect probably benign
Transcript: ENSMUST00000039156
SMART Domains Protein: ENSMUSP00000037417
Gene: ENSMUSG00000036504

DomainStartEndE-ValueType
Pfam:Ocnus 5 116 1e-44 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000095117
SMART Domains Protein: ENSMUSP00000092735
Gene: ENSMUSG00000026941

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
LDLa 32 58 7.33e-1 SMART
MAM 66 227 3.56e-52 SMART
LDLa 233 272 3.5e-9 SMART
MAM 254 430 3.87e-53 SMART
LDLa 461 497 2.63e-4 SMART
MAM 493 653 5.33e-5 SMART
MAM 660 819 3.68e-68 SMART
MAM 820 979 1.07e-28 SMART
MAM 980 1148 2.07e-62 SMART
transmembrane domain 1165 1187 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000095117
SMART Domains Protein: ENSMUSP00000092735
Gene: ENSMUSG00000026941

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
LDLa 32 58 7.33e-1 SMART
MAM 66 227 3.56e-52 SMART
LDLa 233 272 3.5e-9 SMART
MAM 254 430 3.87e-53 SMART
LDLa 461 497 2.63e-4 SMART
MAM 493 653 5.33e-5 SMART
MAM 660 819 3.68e-68 SMART
MAM 820 979 1.07e-28 SMART
MAM 980 1148 2.07e-62 SMART
transmembrane domain 1165 1187 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000114223
SMART Domains Protein: ENSMUSP00000109861
Gene: ENSMUSG00000026941

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
LDLa 28 54 7.33e-1 SMART
MAM 62 223 3.56e-52 SMART
LDLa 229 268 3.5e-9 SMART
MAM 250 426 3.87e-53 SMART
LDLa 457 493 2.63e-4 SMART
MAM 489 649 5.33e-5 SMART
MAM 656 815 3.68e-68 SMART
MAM 816 975 1.07e-28 SMART
MAM 976 1144 2.07e-62 SMART
transmembrane domain 1161 1183 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000114223
SMART Domains Protein: ENSMUSP00000109861
Gene: ENSMUSG00000026941

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
LDLa 28 54 7.33e-1 SMART
MAM 62 223 3.56e-52 SMART
LDLa 229 268 3.5e-9 SMART
MAM 250 426 3.87e-53 SMART
LDLa 457 493 2.63e-4 SMART
MAM 489 649 5.33e-5 SMART
MAM 656 815 3.68e-68 SMART
MAM 816 975 1.07e-28 SMART
MAM 976 1144 2.07e-62 SMART
transmembrane domain 1161 1183 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000135288
Predicted Effect noncoding transcript
Transcript: ENSMUST00000142811
Predicted Effect noncoding transcript
Transcript: ENSMUST00000147096
Predicted Effect noncoding transcript
Transcript: ENSMUST00000152124
Predicted Effect probably null
Transcript: ENSMUST00000152237
SMART Domains Protein: ENSMUSP00000119789
Gene: ENSMUSG00000026941

DomainStartEndE-ValueType
LDLa 9 35 7.33e-1 SMART
MAM 43 204 3.56e-52 SMART
LDLa 210 249 3.5e-9 SMART
MAM 231 407 3.87e-53 SMART
LDLa 438 474 2.63e-4 SMART
MAM 558 717 2.27e-68 SMART
MAM 718 877 1.07e-28 SMART
MAM 878 1046 2.07e-62 SMART
transmembrane domain 1063 1085 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000152237
SMART Domains Protein: ENSMUSP00000119789
Gene: ENSMUSG00000026941

DomainStartEndE-ValueType
LDLa 9 35 7.33e-1 SMART
MAM 43 204 3.56e-52 SMART
LDLa 210 249 3.5e-9 SMART
MAM 231 407 3.87e-53 SMART
LDLa 438 474 2.63e-4 SMART
MAM 558 717 2.27e-68 SMART
MAM 718 877 1.07e-28 SMART
MAM 878 1046 2.07e-62 SMART
transmembrane domain 1063 1085 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.6%
  • 20x: 96.0%
Validation Efficiency 100% (48/48)
Allele List at MGI
Other mutations in this stock
Total: 49 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700123K08Rik T C 5: 138,563,567 D119G probably damaging Het
Abca1 A G 4: 53,089,830 M427T probably benign Het
Ankra2 T C 13: 98,266,404 F53S probably damaging Het
Ano3 T C 2: 110,775,045 E272G probably benign Het
Aqr C T 2: 114,130,534 probably null Het
Clca4b T C 3: 144,928,556 Y92C probably damaging Het
Crebbp A T 16: 4,084,138 N2374K probably damaging Het
Cspg4 A T 9: 56,886,972 I664L probably benign Het
Ctnnd1 A T 2: 84,612,548 D626E probably damaging Het
Eml2 A G 7: 19,194,028 Y254C probably damaging Het
Fam92a A T 4: 12,169,041 probably benign Het
Gabrr3 T C 16: 59,434,668 S239P probably damaging Het
Gen1 T C 12: 11,261,040 T64A probably null Het
Gm14399 C A 2: 175,131,395 C189F probably damaging Het
Gm8251 G A 1: 44,061,381 H186Y probably benign Het
Gm9476 T G 10: 100,307,178 noncoding transcript Het
Kcnh5 A T 12: 75,130,931 F134I possibly damaging Het
Kdm4b G C 17: 56,393,750 A474P probably benign Het
Kif2b TTCTCTCTCT TTCTCTCT 11: 91,576,971 probably null Het
Klk14 G A 7: 43,692,077 C51Y probably damaging Het
Lrrc28 C T 7: 67,545,453 R203Q possibly damaging Het
Lrrc8e G T 8: 4,234,986 E404* probably null Het
Macf1 A T 4: 123,475,556 M239K probably damaging Het
Matr3 A G 18: 35,581,225 Y75C probably damaging Het
Myo19 T C 11: 84,892,221 V187A probably benign Het
Ncbp2 A G 16: 31,956,377 D116G probably damaging Het
Olfr1012 T C 2: 85,760,019 Y119C probably damaging Het
Olfr1208 A C 2: 88,896,703 V298G probably damaging Het
Olfr412 A T 11: 74,364,746 I26F probably benign Het
Olfr679 T A 7: 105,086,302 D195E possibly damaging Het
Pkd1l3 T A 8: 109,633,195 M894K possibly damaging Het
Prpf8 C T 11: 75,487,113 R8* probably null Het
Prss12 T A 3: 123,487,144 S493T probably benign Het
Ptov1 T G 7: 44,867,283 probably benign Het
Rfpl4 A T 7: 5,115,500 L24M probably damaging Het
Rundc1 C A 11: 101,425,331 D76E probably benign Het
Slc5a11 G T 7: 123,273,198 A673S probably damaging Het
Smg5 T C 3: 88,351,561 M613T probably benign Het
Swt1 T A 1: 151,384,468 H677L probably damaging Het
Tas2r107 T C 6: 131,659,603 N161S probably damaging Het
Trp73 A T 4: 154,104,817 probably null Het
Tsr1 A G 11: 74,902,080 I405V probably damaging Het
Ttll4 A G 1: 74,679,829 T280A possibly damaging Het
Ube2q2 A G 9: 55,195,082 probably null Het
Usp5 T C 6: 124,817,410 E769G probably damaging Het
Vmn2r68 T A 7: 85,233,693 K284* probably null Het
Wdr63 A G 3: 146,066,864 S476P possibly damaging Het
Zfp963 C A 8: 69,742,911 K297N probably benign Het
Zfp975 C A 7: 42,661,681 A503S possibly damaging Het
Other mutations in Mamdc4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01304:Mamdc4 APN 2 25563576 missense possibly damaging 0.53
IGL01994:Mamdc4 APN 2 25568534 missense possibly damaging 0.64
IGL02072:Mamdc4 APN 2 25568339 missense probably damaging 1.00
IGL02193:Mamdc4 APN 2 25564446 missense probably benign 0.02
IGL02673:Mamdc4 APN 2 25570054 missense probably benign
IGL03048:Mamdc4 UTSW 2 25569072 missense possibly damaging 0.67
R0135:Mamdc4 UTSW 2 25566920 missense possibly damaging 0.71
R0481:Mamdc4 UTSW 2 25571216 start codon destroyed probably null 0.08
R0490:Mamdc4 UTSW 2 25563581 missense probably benign 0.01
R0609:Mamdc4 UTSW 2 25564193 missense probably benign 0.30
R0729:Mamdc4 UTSW 2 25570036 missense probably damaging 0.98
R1365:Mamdc4 UTSW 2 25566024 missense probably damaging 1.00
R1533:Mamdc4 UTSW 2 25569747 missense possibly damaging 0.71
R1671:Mamdc4 UTSW 2 25568223 nonsense probably null
R1789:Mamdc4 UTSW 2 25567622 missense possibly damaging 0.59
R2002:Mamdc4 UTSW 2 25567232 missense probably damaging 1.00
R2013:Mamdc4 UTSW 2 25563572 missense probably damaging 0.98
R2014:Mamdc4 UTSW 2 25563572 missense probably damaging 0.98
R2056:Mamdc4 UTSW 2 25564168 missense probably benign 0.18
R2109:Mamdc4 UTSW 2 25569390 missense probably damaging 1.00
R2128:Mamdc4 UTSW 2 25569258 missense probably damaging 1.00
R2473:Mamdc4 UTSW 2 25566332 missense probably damaging 0.99
R2496:Mamdc4 UTSW 2 25565902 missense probably damaging 1.00
R3818:Mamdc4 UTSW 2 25565773 missense probably benign
R4591:Mamdc4 UTSW 2 25564597 missense possibly damaging 0.87
R4829:Mamdc4 UTSW 2 25565356 missense possibly damaging 0.85
R4898:Mamdc4 UTSW 2 25570023 missense probably damaging 0.98
R5209:Mamdc4 UTSW 2 25566923 missense probably damaging 0.97
R5268:Mamdc4 UTSW 2 25564690 missense possibly damaging 0.95
R5490:Mamdc4 UTSW 2 25565878 missense probably damaging 1.00
R6152:Mamdc4 UTSW 2 25567439 missense probably damaging 1.00
R6234:Mamdc4 UTSW 2 25570080 missense probably damaging 1.00
R6681:Mamdc4 UTSW 2 25567744 missense probably damaging 1.00
R6774:Mamdc4 UTSW 2 25566936 missense probably benign 0.06
R7178:Mamdc4 UTSW 2 25568965 missense probably benign 0.04
R7225:Mamdc4 UTSW 2 25565546 missense possibly damaging 0.50
R7451:Mamdc4 UTSW 2 25564461 missense possibly damaging 0.80
R7520:Mamdc4 UTSW 2 25565348 missense possibly damaging 0.88
X0022:Mamdc4 UTSW 2 25570192 missense probably damaging 1.00
X0025:Mamdc4 UTSW 2 25564686 missense possibly damaging 0.89
Predicted Primers PCR Primer
(F):5'- CAGCTCAGCGACATCTGTAG -3'
(R):5'- TTGGGTAAGGCCTAGGGAATC -3'

Sequencing Primer
(F):5'- CTCAGCGACATCTGTAGTATTTTGAG -3'
(R):5'- TAAGGCCTAGGGAATCCACGTC -3'
Posted On2014-10-02