Incidental Mutation 'R2185:Olfr1208'
ID237803
Institutional Source Beutler Lab
Gene Symbol Olfr1208
Ensembl Gene ENSMUSG00000075114
Gene Nameolfactory receptor 1208
SynonymsMOR225-4, GA_x6K02T2Q125-50372411-50371485
MMRRC Submission 040187-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.060) question?
Stock #R2185 (G1)
Quality Score225
Status Validated
Chromosome2
Chromosomal Location88895575-88902311 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to C at 88896703 bp
ZygosityHeterozygous
Amino Acid Change Valine to Glycine at position 298 (V298G)
Ref Sequence ENSEMBL: ENSMUSP00000149695 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000099810] [ENSMUST00000214121] [ENSMUST00000214297]
Predicted Effect probably damaging
Transcript: ENSMUST00000099810
AA Change: V298G

PolyPhen 2 Score 0.987 (Sensitivity: 0.73; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000097398
Gene: ENSMUSG00000075114
AA Change: V298G

DomainStartEndE-ValueType
Pfam:7tm_4 28 302 1.9e-48 PFAM
Pfam:7tm_1 38 284 2.6e-17 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000214121
AA Change: V298G

PolyPhen 2 Score 0.987 (Sensitivity: 0.73; Specificity: 0.96)
Predicted Effect probably damaging
Transcript: ENSMUST00000214297
AA Change: V298G

PolyPhen 2 Score 0.987 (Sensitivity: 0.73; Specificity: 0.96)
Meta Mutation Damage Score 0.6084 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.6%
  • 20x: 96.0%
Validation Efficiency 100% (48/48)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 49 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700123K08Rik T C 5: 138,563,567 D119G probably damaging Het
Abca1 A G 4: 53,089,830 M427T probably benign Het
Ankra2 T C 13: 98,266,404 F53S probably damaging Het
Ano3 T C 2: 110,775,045 E272G probably benign Het
Aqr C T 2: 114,130,534 probably null Het
Clca4b T C 3: 144,928,556 Y92C probably damaging Het
Crebbp A T 16: 4,084,138 N2374K probably damaging Het
Cspg4 A T 9: 56,886,972 I664L probably benign Het
Ctnnd1 A T 2: 84,612,548 D626E probably damaging Het
Eml2 A G 7: 19,194,028 Y254C probably damaging Het
Fam92a A T 4: 12,169,041 probably benign Het
Gabrr3 T C 16: 59,434,668 S239P probably damaging Het
Gen1 T C 12: 11,261,040 T64A probably null Het
Gm14399 C A 2: 175,131,395 C189F probably damaging Het
Gm8251 G A 1: 44,061,381 H186Y probably benign Het
Gm9476 T G 10: 100,307,178 noncoding transcript Het
Kcnh5 A T 12: 75,130,931 F134I possibly damaging Het
Kdm4b G C 17: 56,393,750 A474P probably benign Het
Kif2b TTCTCTCTCT TTCTCTCT 11: 91,576,971 probably null Het
Klk14 G A 7: 43,692,077 C51Y probably damaging Het
Lrrc28 C T 7: 67,545,453 R203Q possibly damaging Het
Lrrc8e G T 8: 4,234,986 E404* probably null Het
Macf1 A T 4: 123,475,556 M239K probably damaging Het
Mamdc4 A G 2: 25,569,692 probably null Het
Matr3 A G 18: 35,581,225 Y75C probably damaging Het
Myo19 T C 11: 84,892,221 V187A probably benign Het
Ncbp2 A G 16: 31,956,377 D116G probably damaging Het
Olfr1012 T C 2: 85,760,019 Y119C probably damaging Het
Olfr412 A T 11: 74,364,746 I26F probably benign Het
Olfr679 T A 7: 105,086,302 D195E possibly damaging Het
Pkd1l3 T A 8: 109,633,195 M894K possibly damaging Het
Prpf8 C T 11: 75,487,113 R8* probably null Het
Prss12 T A 3: 123,487,144 S493T probably benign Het
Ptov1 T G 7: 44,867,283 probably benign Het
Rfpl4 A T 7: 5,115,500 L24M probably damaging Het
Rundc1 C A 11: 101,425,331 D76E probably benign Het
Slc5a11 G T 7: 123,273,198 A673S probably damaging Het
Smg5 T C 3: 88,351,561 M613T probably benign Het
Swt1 T A 1: 151,384,468 H677L probably damaging Het
Tas2r107 T C 6: 131,659,603 N161S probably damaging Het
Trp73 A T 4: 154,104,817 probably null Het
Tsr1 A G 11: 74,902,080 I405V probably damaging Het
Ttll4 A G 1: 74,679,829 T280A possibly damaging Het
Ube2q2 A G 9: 55,195,082 probably null Het
Usp5 T C 6: 124,817,410 E769G probably damaging Het
Vmn2r68 T A 7: 85,233,693 K284* probably null Het
Wdr63 A G 3: 146,066,864 S476P possibly damaging Het
Zfp963 C A 8: 69,742,911 K297N probably benign Het
Zfp975 C A 7: 42,661,681 A503S possibly damaging Het
Other mutations in Olfr1208
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01340:Olfr1208 APN 2 88896977 missense probably damaging 1.00
IGL02132:Olfr1208 APN 2 88897159 missense probably benign
IGL02374:Olfr1208 APN 2 88897459 missense probably damaging 1.00
R1378:Olfr1208 UTSW 2 88897026 missense probably benign 0.01
R1570:Olfr1208 UTSW 2 88896946 missense probably damaging 1.00
R2056:Olfr1208 UTSW 2 88896761 missense probably damaging 1.00
R2092:Olfr1208 UTSW 2 88897267 missense probably damaging 0.99
R5223:Olfr1208 UTSW 2 88897334 missense probably benign 0.03
R5479:Olfr1208 UTSW 2 88896691 missense probably benign 0.13
R6463:Olfr1208 UTSW 2 88897118 missense probably benign 0.00
R6859:Olfr1208 UTSW 2 88896934 missense probably benign
R7347:Olfr1208 UTSW 2 88897271 missense possibly damaging 0.51
R7352:Olfr1208 UTSW 2 88896718 missense probably damaging 1.00
R7544:Olfr1208 UTSW 2 88897361 missense probably damaging 1.00
R7713:Olfr1208 UTSW 2 88897778 start gained probably benign
R7842:Olfr1208 UTSW 2 88896961 missense possibly damaging 0.89
R7869:Olfr1208 UTSW 2 88897064 missense probably benign 0.00
R8137:Olfr1208 UTSW 2 88896669 makesense probably null
R8168:Olfr1208 UTSW 2 88896776 missense probably benign 0.09
Z1176:Olfr1208 UTSW 2 88897061 missense probably damaging 1.00
Z1177:Olfr1208 UTSW 2 88896800 nonsense probably null
Predicted Primers PCR Primer
(F):5'- TAGCCATTATATCTGGGATGATGAAGG -3'
(R):5'- ACACATCACCGTTGTATTCATGTTC -3'

Sequencing Primer
(F):5'- GGGATGATGAAGGAGGAAATAATTTC -3'
(R):5'- ACCGTTGTATTCATGTTCTTCTTG -3'
Posted On2014-10-02