Incidental Mutation 'R2185:Wdr63'
ID237810
Institutional Source Beutler Lab
Gene Symbol Wdr63
Ensembl Gene ENSMUSG00000043020
Gene NameWD repeat domain 63
Synonyms4931433A13Rik
MMRRC Submission 040187-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.127) question?
Stock #R2185 (G1)
Quality Score225
Status Validated
Chromosome3
Chromosomal Location146040526-146108130 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 146066864 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 476 (S476P)
Ref Sequence ENSEMBL: ENSMUSP00000124475 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000160285]
Predicted Effect possibly damaging
Transcript: ENSMUST00000160285
AA Change: S476P

PolyPhen 2 Score 0.762 (Sensitivity: 0.85; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000124475
Gene: ENSMUSG00000043020
AA Change: S476P

DomainStartEndE-ValueType
low complexity region 3 22 N/A INTRINSIC
low complexity region 26 35 N/A INTRINSIC
low complexity region 133 150 N/A INTRINSIC
low complexity region 165 180 N/A INTRINSIC
Blast:WD40 321 367 6e-19 BLAST
low complexity region 375 383 N/A INTRINSIC
WD40 390 429 6.34e-2 SMART
WD40 470 527 1.15e-4 SMART
low complexity region 536 553 N/A INTRINSIC
WD40 693 732 1.07e1 SMART
WD40 737 776 1.1e2 SMART
coiled coil region 867 902 N/A INTRINSIC
Meta Mutation Damage Score 0.042 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.6%
  • 20x: 96.0%
Validation Efficiency 100% (48/48)
Allele List at MGI
Other mutations in this stock
Total: 49 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700123K08Rik T C 5: 138,563,567 D119G probably damaging Het
Abca1 A G 4: 53,089,830 M427T probably benign Het
Ankra2 T C 13: 98,266,404 F53S probably damaging Het
Ano3 T C 2: 110,775,045 E272G probably benign Het
Aqr C T 2: 114,130,534 probably null Het
Clca4b T C 3: 144,928,556 Y92C probably damaging Het
Crebbp A T 16: 4,084,138 N2374K probably damaging Het
Cspg4 A T 9: 56,886,972 I664L probably benign Het
Ctnnd1 A T 2: 84,612,548 D626E probably damaging Het
Eml2 A G 7: 19,194,028 Y254C probably damaging Het
Fam92a A T 4: 12,169,041 probably benign Het
Gabrr3 T C 16: 59,434,668 S239P probably damaging Het
Gen1 T C 12: 11,261,040 T64A probably null Het
Gm14399 C A 2: 175,131,395 C189F probably damaging Het
Gm8251 G A 1: 44,061,381 H186Y probably benign Het
Gm9476 T G 10: 100,307,178 noncoding transcript Het
Kcnh5 A T 12: 75,130,931 F134I possibly damaging Het
Kdm4b G C 17: 56,393,750 A474P probably benign Het
Kif2b TTCTCTCTCT TTCTCTCT 11: 91,576,971 probably null Het
Klk14 G A 7: 43,692,077 C51Y probably damaging Het
Lrrc28 C T 7: 67,545,453 R203Q possibly damaging Het
Lrrc8e G T 8: 4,234,986 E404* probably null Het
Macf1 A T 4: 123,475,556 M239K probably damaging Het
Mamdc4 A G 2: 25,569,692 probably null Het
Matr3 A G 18: 35,581,225 Y75C probably damaging Het
Myo19 T C 11: 84,892,221 V187A probably benign Het
Ncbp2 A G 16: 31,956,377 D116G probably damaging Het
Olfr1012 T C 2: 85,760,019 Y119C probably damaging Het
Olfr1208 A C 2: 88,896,703 V298G probably damaging Het
Olfr412 A T 11: 74,364,746 I26F probably benign Het
Olfr679 T A 7: 105,086,302 D195E possibly damaging Het
Pkd1l3 T A 8: 109,633,195 M894K possibly damaging Het
Prpf8 C T 11: 75,487,113 R8* probably null Het
Prss12 T A 3: 123,487,144 S493T probably benign Het
Ptov1 T G 7: 44,867,283 probably benign Het
Rfpl4 A T 7: 5,115,500 L24M probably damaging Het
Rundc1 C A 11: 101,425,331 D76E probably benign Het
Slc5a11 G T 7: 123,273,198 A673S probably damaging Het
Smg5 T C 3: 88,351,561 M613T probably benign Het
Swt1 T A 1: 151,384,468 H677L probably damaging Het
Tas2r107 T C 6: 131,659,603 N161S probably damaging Het
Trp73 A T 4: 154,104,817 probably null Het
Tsr1 A G 11: 74,902,080 I405V probably damaging Het
Ttll4 A G 1: 74,679,829 T280A possibly damaging Het
Ube2q2 A G 9: 55,195,082 probably null Het
Usp5 T C 6: 124,817,410 E769G probably damaging Het
Vmn2r68 T A 7: 85,233,693 K284* probably null Het
Zfp963 C A 8: 69,742,911 K297N probably benign Het
Zfp975 C A 7: 42,661,681 A503S possibly damaging Het
Other mutations in Wdr63
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00093:Wdr63 APN 3 146083004 missense probably benign
IGL00565:Wdr63 APN 3 146044919 splice site probably benign
IGL01339:Wdr63 APN 3 146042836 missense probably benign 0.14
IGL01952:Wdr63 APN 3 146097163 missense probably damaging 0.96
IGL02663:Wdr63 APN 3 146054557 missense possibly damaging 0.53
IGL02710:Wdr63 APN 3 146048148 missense possibly damaging 0.96
P0041:Wdr63 UTSW 3 146081242 missense possibly damaging 0.96
R0014:Wdr63 UTSW 3 146081423 splice site probably null
R0014:Wdr63 UTSW 3 146081423 splice site probably null
R0498:Wdr63 UTSW 3 146081364 missense possibly damaging 0.54
R0589:Wdr63 UTSW 3 146062331 missense probably benign 0.01
R1484:Wdr63 UTSW 3 146097241 missense probably benign 0.02
R1537:Wdr63 UTSW 3 146042749 missense probably damaging 0.98
R1611:Wdr63 UTSW 3 146095358 missense probably damaging 1.00
R1743:Wdr63 UTSW 3 146097262 missense possibly damaging 0.81
R1861:Wdr63 UTSW 3 146083046 missense probably damaging 1.00
R1991:Wdr63 UTSW 3 146063480 missense possibly damaging 0.82
R4299:Wdr63 UTSW 3 146068806 missense probably damaging 1.00
R4620:Wdr63 UTSW 3 146042809 missense probably damaging 1.00
R4649:Wdr63 UTSW 3 146048167 missense probably damaging 1.00
R4914:Wdr63 UTSW 3 146066827 missense probably damaging 0.98
R4948:Wdr63 UTSW 3 146083065 nonsense probably null
R5578:Wdr63 UTSW 3 146097228 nonsense probably null
R6130:Wdr63 UTSW 3 146042804 missense probably benign 0.25
R6162:Wdr63 UTSW 3 146044862 missense probably damaging 1.00
R6291:Wdr63 UTSW 3 146066893 missense probably benign 0.00
R6390:Wdr63 UTSW 3 146095388 missense probably damaging 1.00
R6560:Wdr63 UTSW 3 146095406 missense possibly damaging 0.79
R6893:Wdr63 UTSW 3 146080429 missense probably damaging 1.00
R7090:Wdr63 UTSW 3 146040827 missense possibly damaging 0.80
R7102:Wdr63 UTSW 3 146055704 missense possibly damaging 0.49
R7111:Wdr63 UTSW 3 146097273 missense probably damaging 0.99
R7260:Wdr63 UTSW 3 146046540 missense probably benign 0.01
R7288:Wdr63 UTSW 3 146081252 missense probably damaging 0.97
R7411:Wdr63 UTSW 3 146097145 missense probably damaging 0.98
R7466:Wdr63 UTSW 3 146055618 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- GAAGCTAGAGCGAACTCCTAAAGC -3'
(R):5'- TGGTATAGGGAAACACGAATTTGTG -3'

Sequencing Primer
(F):5'- TTAGTACAGCGCTTGCCAAG -3'
(R):5'- CACGAATTTGTGTTTTACCTTAACTG -3'
Posted On2014-10-02