Incidental Mutation 'R2185:Rfpl4'
ID237819
Institutional Source Beutler Lab
Gene Symbol Rfpl4
Ensembl Gene ENSMUSG00000035191
Gene Nameret finger protein-like 4
SynonymsD7Ertd486e
MMRRC Submission 040187-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.102) question?
Stock #R2185 (G1)
Quality Score225
Status Validated
Chromosome7
Chromosomal Location5109787-5116950 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 5115500 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Methionine at position 24 (L24M)
Ref Sequence ENSEMBL: ENSMUSP00000146891 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000045215] [ENSMUST00000179971] [ENSMUST00000208468]
Predicted Effect probably damaging
Transcript: ENSMUST00000045215
AA Change: L24M

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000039519
Gene: ENSMUSG00000035191
AA Change: L24M

DomainStartEndE-ValueType
RING 14 52 4.52e-3 SMART
PRY 95 147 2.51e-10 SMART
SPRY 148 275 2e-19 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000179971
AA Change: L24M

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000136497
Gene: ENSMUSG00000035191
AA Change: L24M

DomainStartEndE-ValueType
RING 14 52 4.52e-3 SMART
PRY 95 147 2.51e-10 SMART
SPRY 148 275 2e-19 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000208468
AA Change: L24M

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Meta Mutation Damage Score 0.6467 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.6%
  • 20x: 96.0%
Validation Efficiency 100% (48/48)
Allele List at MGI
Other mutations in this stock
Total: 49 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700123K08Rik T C 5: 138,563,567 D119G probably damaging Het
Abca1 A G 4: 53,089,830 M427T probably benign Het
Ankra2 T C 13: 98,266,404 F53S probably damaging Het
Ano3 T C 2: 110,775,045 E272G probably benign Het
Aqr C T 2: 114,130,534 probably null Het
Clca4b T C 3: 144,928,556 Y92C probably damaging Het
Crebbp A T 16: 4,084,138 N2374K probably damaging Het
Cspg4 A T 9: 56,886,972 I664L probably benign Het
Ctnnd1 A T 2: 84,612,548 D626E probably damaging Het
Eml2 A G 7: 19,194,028 Y254C probably damaging Het
Fam92a A T 4: 12,169,041 probably benign Het
Gabrr3 T C 16: 59,434,668 S239P probably damaging Het
Gen1 T C 12: 11,261,040 T64A probably null Het
Gm14399 C A 2: 175,131,395 C189F probably damaging Het
Gm8251 G A 1: 44,061,381 H186Y probably benign Het
Gm9476 T G 10: 100,307,178 noncoding transcript Het
Kcnh5 A T 12: 75,130,931 F134I possibly damaging Het
Kdm4b G C 17: 56,393,750 A474P probably benign Het
Kif2b TTCTCTCTCT TTCTCTCT 11: 91,576,971 probably null Het
Klk14 G A 7: 43,692,077 C51Y probably damaging Het
Lrrc28 C T 7: 67,545,453 R203Q possibly damaging Het
Lrrc8e G T 8: 4,234,986 E404* probably null Het
Macf1 A T 4: 123,475,556 M239K probably damaging Het
Mamdc4 A G 2: 25,569,692 probably null Het
Matr3 A G 18: 35,581,225 Y75C probably damaging Het
Myo19 T C 11: 84,892,221 V187A probably benign Het
Ncbp2 A G 16: 31,956,377 D116G probably damaging Het
Olfr1012 T C 2: 85,760,019 Y119C probably damaging Het
Olfr1208 A C 2: 88,896,703 V298G probably damaging Het
Olfr412 A T 11: 74,364,746 I26F probably benign Het
Olfr679 T A 7: 105,086,302 D195E possibly damaging Het
Pkd1l3 T A 8: 109,633,195 M894K possibly damaging Het
Prpf8 C T 11: 75,487,113 R8* probably null Het
Prss12 T A 3: 123,487,144 S493T probably benign Het
Ptov1 T G 7: 44,867,283 probably benign Het
Rundc1 C A 11: 101,425,331 D76E probably benign Het
Slc5a11 G T 7: 123,273,198 A673S probably damaging Het
Smg5 T C 3: 88,351,561 M613T probably benign Het
Swt1 T A 1: 151,384,468 H677L probably damaging Het
Tas2r107 T C 6: 131,659,603 N161S probably damaging Het
Trp73 A T 4: 154,104,817 probably null Het
Tsr1 A G 11: 74,902,080 I405V probably damaging Het
Ttll4 A G 1: 74,679,829 T280A possibly damaging Het
Ube2q2 A G 9: 55,195,082 probably null Het
Usp5 T C 6: 124,817,410 E769G probably damaging Het
Vmn2r68 T A 7: 85,233,693 K284* probably null Het
Wdr63 A G 3: 146,066,864 S476P possibly damaging Het
Zfp963 C A 8: 69,742,911 K297N probably benign Het
Zfp975 C A 7: 42,661,681 A503S possibly damaging Het
Other mutations in Rfpl4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL03377:Rfpl4 APN 7 5110465 missense probably damaging 1.00
R0285:Rfpl4 UTSW 7 5110378 missense probably benign 0.01
R0727:Rfpl4 UTSW 7 5115293 missense probably benign 0.20
R1024:Rfpl4 UTSW 7 5110518 missense probably damaging 1.00
R1529:Rfpl4 UTSW 7 5110712 missense probably damaging 1.00
R1625:Rfpl4 UTSW 7 5115410 missense possibly damaging 0.62
R1714:Rfpl4 UTSW 7 5110358 missense probably benign 0.34
R1960:Rfpl4 UTSW 7 5115534 nonsense probably null
R2167:Rfpl4 UTSW 7 5110853 missense probably damaging 1.00
R4385:Rfpl4 UTSW 7 5110670 missense possibly damaging 0.93
R5988:Rfpl4 UTSW 7 5115502 missense probably damaging 1.00
R7082:Rfpl4 UTSW 7 5115559 missense probably benign 0.01
R7212:Rfpl4 UTSW 7 5110660 missense probably damaging 1.00
R7772:Rfpl4 UTSW 7 5115544 missense probably benign 0.05
R8271:Rfpl4 UTSW 7 5110540 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- AGAGCACCTTATGGATTTGGAGATG -3'
(R):5'- TCATGTCATCCCGTGCAACG -3'

Sequencing Primer
(F):5'- CGGAAGACCTCTTACCTTGAAATATC -3'
(R):5'- CGATGCCAAGCTCCCAAG -3'
Posted On2014-10-02