Incidental Mutation 'R2185:Vmn2r68'
ID237824
Institutional Source Beutler Lab
Gene Symbol Vmn2r68
Ensembl Gene ENSMUSG00000096861
Gene Namevomeronasal 2, receptor 68
SynonymsVmn2r68-ps, EG620697
MMRRC Submission 040187-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.108) question?
Stock #R2185 (G1)
Quality Score225
Status Validated
Chromosome7
Chromosomal Location85221518-85237704 bp(-) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) T to A at 85233693 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Stop codon at position 284 (K284*)
Ref Sequence ENSEMBL: ENSMUSP00000129411 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000061074]
Predicted Effect probably null
Transcript: ENSMUST00000061074
AA Change: K284*
SMART Domains Protein: ENSMUSP00000129411
Gene: ENSMUSG00000096861
AA Change: K284*

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
Pfam:ANF_receptor 77 463 4.5e-28 PFAM
Pfam:NCD3G 507 559 1.1e-18 PFAM
Pfam:7tm_3 589 827 3.7e-53 PFAM
Meta Mutation Damage Score 0.9755 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.6%
  • 20x: 96.0%
Validation Efficiency 100% (48/48)
Allele List at MGI
Other mutations in this stock
Total: 49 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700123K08Rik T C 5: 138,563,567 D119G probably damaging Het
Abca1 A G 4: 53,089,830 M427T probably benign Het
Ankra2 T C 13: 98,266,404 F53S probably damaging Het
Ano3 T C 2: 110,775,045 E272G probably benign Het
Aqr C T 2: 114,130,534 probably null Het
Clca4b T C 3: 144,928,556 Y92C probably damaging Het
Crebbp A T 16: 4,084,138 N2374K probably damaging Het
Cspg4 A T 9: 56,886,972 I664L probably benign Het
Ctnnd1 A T 2: 84,612,548 D626E probably damaging Het
Eml2 A G 7: 19,194,028 Y254C probably damaging Het
Fam92a A T 4: 12,169,041 probably benign Het
Gabrr3 T C 16: 59,434,668 S239P probably damaging Het
Gen1 T C 12: 11,261,040 T64A probably null Het
Gm14399 C A 2: 175,131,395 C189F probably damaging Het
Gm8251 G A 1: 44,061,381 H186Y probably benign Het
Gm9476 T G 10: 100,307,178 noncoding transcript Het
Kcnh5 A T 12: 75,130,931 F134I possibly damaging Het
Kdm4b G C 17: 56,393,750 A474P probably benign Het
Kif2b TTCTCTCTCT TTCTCTCT 11: 91,576,971 probably null Het
Klk14 G A 7: 43,692,077 C51Y probably damaging Het
Lrrc28 C T 7: 67,545,453 R203Q possibly damaging Het
Lrrc8e G T 8: 4,234,986 E404* probably null Het
Macf1 A T 4: 123,475,556 M239K probably damaging Het
Mamdc4 A G 2: 25,569,692 probably null Het
Matr3 A G 18: 35,581,225 Y75C probably damaging Het
Myo19 T C 11: 84,892,221 V187A probably benign Het
Ncbp2 A G 16: 31,956,377 D116G probably damaging Het
Olfr1012 T C 2: 85,760,019 Y119C probably damaging Het
Olfr1208 A C 2: 88,896,703 V298G probably damaging Het
Olfr412 A T 11: 74,364,746 I26F probably benign Het
Olfr679 T A 7: 105,086,302 D195E possibly damaging Het
Pkd1l3 T A 8: 109,633,195 M894K possibly damaging Het
Prpf8 C T 11: 75,487,113 R8* probably null Het
Prss12 T A 3: 123,487,144 S493T probably benign Het
Ptov1 T G 7: 44,867,283 probably benign Het
Rfpl4 A T 7: 5,115,500 L24M probably damaging Het
Rundc1 C A 11: 101,425,331 D76E probably benign Het
Slc5a11 G T 7: 123,273,198 A673S probably damaging Het
Smg5 T C 3: 88,351,561 M613T probably benign Het
Swt1 T A 1: 151,384,468 H677L probably damaging Het
Tas2r107 T C 6: 131,659,603 N161S probably damaging Het
Trp73 A T 4: 154,104,817 probably null Het
Tsr1 A G 11: 74,902,080 I405V probably damaging Het
Ttll4 A G 1: 74,679,829 T280A possibly damaging Het
Ube2q2 A G 9: 55,195,082 probably null Het
Usp5 T C 6: 124,817,410 E769G probably damaging Het
Wdr63 A G 3: 146,066,864 S476P possibly damaging Het
Zfp963 C A 8: 69,742,911 K297N probably benign Het
Zfp975 C A 7: 42,661,681 A503S possibly damaging Het
Other mutations in Vmn2r68
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01391:Vmn2r68 APN 7 85237611 missense probably benign
IGL01477:Vmn2r68 APN 7 85233483 missense probably damaging 1.00
IGL01600:Vmn2r68 APN 7 85222260 missense probably benign 0.39
IGL01979:Vmn2r68 APN 7 85222117 missense probably benign
IGL01999:Vmn2r68 APN 7 85222231 missense probably damaging 1.00
IGL02269:Vmn2r68 APN 7 85221739 missense possibly damaging 0.84
IGL02517:Vmn2r68 APN 7 85221945 nonsense probably null
IGL02827:Vmn2r68 APN 7 85237592 missense probably damaging 1.00
IGL02852:Vmn2r68 APN 7 85233387 missense probably damaging 1.00
IGL02982:Vmn2r68 APN 7 85234441 missense probably benign 0.12
IGL03099:Vmn2r68 APN 7 85222240 nonsense probably null
IGL03166:Vmn2r68 APN 7 85222123 missense probably benign 0.01
IGL03168:Vmn2r68 APN 7 85221764 missense probably damaging 1.00
IGL03243:Vmn2r68 APN 7 85233755 missense possibly damaging 0.66
F5770:Vmn2r68 UTSW 7 85221880 missense probably benign 0.01
R0280:Vmn2r68 UTSW 7 85233249 splice site probably benign
R0280:Vmn2r68 UTSW 7 85233258 critical splice donor site probably null
R0281:Vmn2r68 UTSW 7 85233249 splice site probably benign
R0281:Vmn2r68 UTSW 7 85233258 critical splice donor site probably null
R0348:Vmn2r68 UTSW 7 85221676 missense possibly damaging 0.50
R0390:Vmn2r68 UTSW 7 85233249 splice site probably benign
R0390:Vmn2r68 UTSW 7 85233258 critical splice donor site probably null
R0722:Vmn2r68 UTSW 7 85221586 missense possibly damaging 0.95
R1129:Vmn2r68 UTSW 7 85237504 splice site probably null
R1136:Vmn2r68 UTSW 7 85222341 missense possibly damaging 0.81
R1319:Vmn2r68 UTSW 7 85232492 missense probably damaging 0.96
R1614:Vmn2r68 UTSW 7 85221738 missense possibly damaging 0.93
R1682:Vmn2r68 UTSW 7 85233366 missense possibly damaging 0.68
R1837:Vmn2r68 UTSW 7 85233678 missense probably damaging 0.96
R1893:Vmn2r68 UTSW 7 85234659 nonsense probably null
R1908:Vmn2r68 UTSW 7 85234052 missense probably benign 0.09
R1909:Vmn2r68 UTSW 7 85234052 missense probably benign 0.09
R1951:Vmn2r68 UTSW 7 85233894 missense probably damaging 1.00
R2177:Vmn2r68 UTSW 7 85221915 missense probably benign 0.01
R2178:Vmn2r68 UTSW 7 85221550 frame shift probably null
R2188:Vmn2r68 UTSW 7 85221550 frame shift probably null
R2282:Vmn2r68 UTSW 7 85221651 missense possibly damaging 0.65
R2567:Vmn2r68 UTSW 7 85234595 missense probably benign
R2869:Vmn2r68 UTSW 7 85233626 missense probably benign 0.25
R2869:Vmn2r68 UTSW 7 85233626 missense probably benign 0.25
R2870:Vmn2r68 UTSW 7 85233626 missense probably benign 0.25
R2870:Vmn2r68 UTSW 7 85233626 missense probably benign 0.25
R2871:Vmn2r68 UTSW 7 85233626 missense probably benign 0.25
R2871:Vmn2r68 UTSW 7 85233626 missense probably benign 0.25
R2873:Vmn2r68 UTSW 7 85233626 missense probably benign 0.25
R2874:Vmn2r68 UTSW 7 85233626 missense probably benign 0.25
R3149:Vmn2r68 UTSW 7 85237667 missense probably benign 0.00
R3401:Vmn2r68 UTSW 7 85221550 frame shift probably null
R3978:Vmn2r68 UTSW 7 85232462 missense probably benign 0.00
R4399:Vmn2r68 UTSW 7 85221550 frame shift probably null
R4401:Vmn2r68 UTSW 7 85221550 frame shift probably null
R4421:Vmn2r68 UTSW 7 85221550 frame shift probably null
R4478:Vmn2r68 UTSW 7 85221550 frame shift probably null
R4479:Vmn2r68 UTSW 7 85221550 frame shift probably null
R4495:Vmn2r68 UTSW 7 85221550 frame shift probably null
R4628:Vmn2r68 UTSW 7 85234465 missense probably benign 0.00
R4649:Vmn2r68 UTSW 7 85221535 missense probably benign
R4654:Vmn2r68 UTSW 7 85233561 nonsense probably null
R4793:Vmn2r68 UTSW 7 85234440 missense probably benign 0.01
R5007:Vmn2r68 UTSW 7 85232414 missense probably benign
R5021:Vmn2r68 UTSW 7 85233734 missense possibly damaging 0.62
R5082:Vmn2r68 UTSW 7 85233868 missense probably benign 0.12
R5177:Vmn2r68 UTSW 7 85221991 missense probably damaging 0.99
R5221:Vmn2r68 UTSW 7 85221877 missense probably damaging 1.00
R5514:Vmn2r68 UTSW 7 85237559 missense possibly damaging 0.92
R5521:Vmn2r68 UTSW 7 85233718 missense probably benign 0.03
R5563:Vmn2r68 UTSW 7 85222075 missense probably damaging 1.00
R5664:Vmn2r68 UTSW 7 85233770 missense probably benign 0.02
R5829:Vmn2r68 UTSW 7 85237604 missense probably benign 0.00
R6016:Vmn2r68 UTSW 7 85222245 missense probably damaging 0.99
R6356:Vmn2r68 UTSW 7 85233840 missense possibly damaging 0.85
R6413:Vmn2r68 UTSW 7 85221765 missense probably damaging 1.00
R6418:Vmn2r68 UTSW 7 85233707 missense probably benign
R6699:Vmn2r68 UTSW 7 85232375 missense possibly damaging 0.58
R7287:Vmn2r68 UTSW 7 85222252 missense probably benign 0.33
R7319:Vmn2r68 UTSW 7 85233834 missense probably benign
R7374:Vmn2r68 UTSW 7 85232399 missense possibly damaging 0.66
R7585:Vmn2r68 UTSW 7 85232379 missense probably damaging 1.00
R7605:Vmn2r68 UTSW 7 85233908 missense probably benign 0.01
R7892:Vmn2r68 UTSW 7 85234514 missense probably benign
R7979:Vmn2r68 UTSW 7 85234417 critical splice donor site probably null
R8177:Vmn2r68 UTSW 7 85222214 nonsense probably null
R8349:Vmn2r68 UTSW 7 85233577 missense probably damaging 1.00
R8378:Vmn2r68 UTSW 7 85221900 missense probably benign 0.00
R8397:Vmn2r68 UTSW 7 85237514 missense possibly damaging 0.71
R8449:Vmn2r68 UTSW 7 85233577 missense probably damaging 1.00
V7581:Vmn2r68 UTSW 7 85221880 missense probably benign 0.01
Z1176:Vmn2r68 UTSW 7 85221733 missense probably damaging 1.00
Z1176:Vmn2r68 UTSW 7 85222081 missense probably benign 0.27
Z1176:Vmn2r68 UTSW 7 85222099 missense possibly damaging 0.92
Predicted Primers PCR Primer
(F):5'- CAATTAAATGGTGGCAAAGAACACC -3'
(R):5'- ACTGGATAGGAGCGATGATTAC -3'

Sequencing Primer
(F):5'- TGGCAAAGGAAAATTCACTACTG -3'
(R):5'- GCGATGATTACAAATGATGACCATG -3'
Posted On2014-10-02