Incidental Mutation 'R2185:Ankra2'
ID237842
Institutional Source Beutler Lab
Gene Symbol Ankra2
Ensembl Gene ENSMUSG00000021661
Gene Nameankyrin repeat, family A (RFXANK-like), 2
Synonyms
MMRRC Submission 040187-MU
Accession Numbers

Ncbi RefSeq: NM_001271388.1, NM_001271389.1, NM_001271390.1, NM_023472.2, NM_001271391.1, NM_001271392.1; MGI: 1915808

Is this an essential gene? Probably non essential (E-score: 0.248) question?
Stock #R2185 (G1)
Quality Score225
Status Validated
Chromosome13
Chromosomal Location98263074-98274754 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 98266404 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Serine at position 53 (F53S)
Ref Sequence ENSEMBL: ENSMUSP00000022164 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000022164] [ENSMUST00000040972] [ENSMUST00000091356] [ENSMUST00000123924] [ENSMUST00000150352] [ENSMUST00000150916] [ENSMUST00000226100]
Predicted Effect probably damaging
Transcript: ENSMUST00000022164
AA Change: F53S

PolyPhen 2 Score 0.987 (Sensitivity: 0.73; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000022164
Gene: ENSMUSG00000021661
AA Change: F53S

DomainStartEndE-ValueType
ANK 180 209 1.45e-6 SMART
ANK 213 242 1.05e-3 SMART
ANK 246 275 1.76e-5 SMART
Blast:ANK 279 308 1e-7 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000040972
SMART Domains Protein: ENSMUSP00000048204
Gene: ENSMUSG00000041747

DomainStartEndE-ValueType
WD40 31 66 6.85e1 SMART
WD40 69 108 1.66e-5 SMART
WD40 111 150 2.82e-8 SMART
WD40 153 193 7.33e-7 SMART
WD40 196 233 3.9e-2 SMART
WD40 237 276 1.39e-7 SMART
WD40 279 317 1.7e2 SMART
Pfam:UTP15_C 343 490 3.5e-50 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000091356
SMART Domains Protein: ENSMUSP00000088915
Gene: ENSMUSG00000021661

DomainStartEndE-ValueType
ANK 20 49 1.45e-6 SMART
ANK 53 82 1.05e-3 SMART
ANK 86 115 1.76e-5 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000123924
AA Change: F53S

PolyPhen 2 Score 0.983 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000122701
Gene: ENSMUSG00000021661
AA Change: F53S

DomainStartEndE-ValueType
ANK 180 209 1.45e-6 SMART
ANK 213 242 1.05e-3 SMART
ANK 246 275 1.76e-5 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000150352
AA Change: F53S

PolyPhen 2 Score 0.975 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000117508
Gene: ENSMUSG00000021661
AA Change: F53S

DomainStartEndE-ValueType
ANK 180 209 1.45e-6 SMART
ANK 213 242 1.05e-3 SMART
ANK 246 275 1.76e-5 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000150916
SMART Domains Protein: ENSMUSP00000116590
Gene: ENSMUSG00000021661

DomainStartEndE-ValueType
ANK 20 49 1.45e-6 SMART
ANK 53 82 1.05e-3 SMART
ANK 86 115 1.76e-5 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000155629
Predicted Effect noncoding transcript
Transcript: ENSMUST00000223606
Predicted Effect noncoding transcript
Transcript: ENSMUST00000224842
Predicted Effect probably benign
Transcript: ENSMUST00000226100
Meta Mutation Damage Score 0.3409 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.6%
  • 20x: 96.0%
Validation Efficiency 100% (48/48)
Allele List at MGI

All alleles(3) : Targeted(2) Gene trapped(1)

Other mutations in this stock
Total: 49 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700123K08Rik T C 5: 138,563,567 D119G probably damaging Het
Abca1 A G 4: 53,089,830 M427T probably benign Het
Ano3 T C 2: 110,775,045 E272G probably benign Het
Aqr C T 2: 114,130,534 probably null Het
Clca4b T C 3: 144,928,556 Y92C probably damaging Het
Crebbp A T 16: 4,084,138 N2374K probably damaging Het
Cspg4 A T 9: 56,886,972 I664L probably benign Het
Ctnnd1 A T 2: 84,612,548 D626E probably damaging Het
Eml2 A G 7: 19,194,028 Y254C probably damaging Het
Fam92a A T 4: 12,169,041 probably benign Het
Gabrr3 T C 16: 59,434,668 S239P probably damaging Het
Gen1 T C 12: 11,261,040 T64A probably null Het
Gm14399 C A 2: 175,131,395 C189F probably damaging Het
Gm8251 G A 1: 44,061,381 H186Y probably benign Het
Gm9476 T G 10: 100,307,178 noncoding transcript Het
Kcnh5 A T 12: 75,130,931 F134I possibly damaging Het
Kdm4b G C 17: 56,393,750 A474P probably benign Het
Kif2b TTCTCTCTCT TTCTCTCT 11: 91,576,971 probably null Het
Klk14 G A 7: 43,692,077 C51Y probably damaging Het
Lrrc28 C T 7: 67,545,453 R203Q possibly damaging Het
Lrrc8e G T 8: 4,234,986 E404* probably null Het
Macf1 A T 4: 123,475,556 M239K probably damaging Het
Mamdc4 A G 2: 25,569,692 probably null Het
Matr3 A G 18: 35,581,225 Y75C probably damaging Het
Myo19 T C 11: 84,892,221 V187A probably benign Het
Ncbp2 A G 16: 31,956,377 D116G probably damaging Het
Olfr1012 T C 2: 85,760,019 Y119C probably damaging Het
Olfr1208 A C 2: 88,896,703 V298G probably damaging Het
Olfr412 A T 11: 74,364,746 I26F probably benign Het
Olfr679 T A 7: 105,086,302 D195E possibly damaging Het
Pkd1l3 T A 8: 109,633,195 M894K possibly damaging Het
Prpf8 C T 11: 75,487,113 R8* probably null Het
Prss12 T A 3: 123,487,144 S493T probably benign Het
Ptov1 T G 7: 44,867,283 probably benign Het
Rfpl4 A T 7: 5,115,500 L24M probably damaging Het
Rundc1 C A 11: 101,425,331 D76E probably benign Het
Slc5a11 G T 7: 123,273,198 A673S probably damaging Het
Smg5 T C 3: 88,351,561 M613T probably benign Het
Swt1 T A 1: 151,384,468 H677L probably damaging Het
Tas2r107 T C 6: 131,659,603 N161S probably damaging Het
Trp73 A T 4: 154,104,817 probably null Het
Tsr1 A G 11: 74,902,080 I405V probably damaging Het
Ttll4 A G 1: 74,679,829 T280A possibly damaging Het
Ube2q2 A G 9: 55,195,082 probably null Het
Usp5 T C 6: 124,817,410 E769G probably damaging Het
Vmn2r68 T A 7: 85,233,693 K284* probably null Het
Wdr63 A G 3: 146,066,864 S476P possibly damaging Het
Zfp963 C A 8: 69,742,911 K297N probably benign Het
Zfp975 C A 7: 42,661,681 A503S possibly damaging Het
Other mutations in Ankra2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02168:Ankra2 APN 13 98273374 splice site probably benign
IGL02807:Ankra2 APN 13 98271742 missense probably damaging 1.00
IGL03030:Ankra2 APN 13 98273373 splice site probably benign
R0068:Ankra2 UTSW 13 98273383 nonsense probably null
R0068:Ankra2 UTSW 13 98273383 nonsense probably null
R0302:Ankra2 UTSW 13 98271692 missense probably damaging 1.00
R0499:Ankra2 UTSW 13 98266454 missense probably damaging 1.00
R0729:Ankra2 UTSW 13 98271727 missense probably damaging 1.00
R1848:Ankra2 UTSW 13 98271124 missense probably damaging 1.00
R2230:Ankra2 UTSW 13 98271138 missense probably damaging 0.99
R2232:Ankra2 UTSW 13 98271138 missense probably damaging 0.99
R3898:Ankra2 UTSW 13 98273809 missense probably benign 0.13
R4605:Ankra2 UTSW 13 98266234 intron probably benign
R4855:Ankra2 UTSW 13 98273411 missense probably damaging 1.00
R5806:Ankra2 UTSW 13 98268497 critical splice donor site probably null
R5901:Ankra2 UTSW 13 98271136 missense probably damaging 0.99
R6478:Ankra2 UTSW 13 98268442 missense probably damaging 1.00
R7469:Ankra2 UTSW 13 98266374 missense probably benign 0.01
Z1177:Ankra2 UTSW 13 98272277 missense possibly damaging 0.73
Predicted Primers PCR Primer
(F):5'- ACAAGAGCAGTGTTTGGGTG -3'
(R):5'- GATGACTTTCAAGCTTTTCCTCAAC -3'

Sequencing Primer
(F):5'- CAGGAAAATACTGGATAACACCTTTG -3'
(R):5'- CTCCTGATTCAAAGAAAACAGAATGG -3'
Posted On2014-10-02