Incidental Mutation 'R0178:Tmprss7'
ID23785
Institutional Source Beutler Lab
Gene Symbol Tmprss7
Ensembl Gene ENSMUSG00000033177
Gene Nametransmembrane serine protease 7
Synonymsmatriptase-3, B230219I23Rik, LOC385645
MMRRC Submission 038446-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.106) question?
Stock #R0178 (G1)
Quality Score225
Status Validated (trace)
Chromosome16
Chromosomal Location45656315-45693658 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 45690843 bp
ZygosityHeterozygous
Amino Acid Change Tryptophan to Cysteine at position 57 (W57C)
Ref Sequence ENSEMBL: ENSMUSP00000110209 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000114562]
Predicted Effect probably damaging
Transcript: ENSMUST00000114562
AA Change: W57C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000110209
Gene: ENSMUSG00000033177
AA Change: W57C

DomainStartEndE-ValueType
low complexity region 28 55 N/A INTRINSIC
transmembrane domain 63 85 N/A INTRINSIC
Pfam:SEA 94 198 4.6e-23 PFAM
CUB 233 346 9.35e-4 SMART
Pfam:CUB 351 454 3e-7 PFAM
LDLa 469 506 5.63e-13 SMART
LDLa 510 541 5.56e-2 SMART
LDLa 544 582 8.95e-7 SMART
Tryp_SPc 591 821 7.17e-85 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000169421
Predicted Effect noncoding transcript
Transcript: ENSMUST00000178150
Predicted Effect noncoding transcript
Transcript: ENSMUST00000178323
Meta Mutation Damage Score 0.1033 question?
Coding Region Coverage
  • 1x: 98.9%
  • 3x: 98.1%
  • 10x: 95.5%
  • 20x: 88.8%
Validation Efficiency 95% (69/73)
Allele List at MGI
Other mutations in this stock
Total: 53 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700125H20Rik A G 11: 85,178,438 H94R probably benign Het
4922502D21Rik T C 6: 129,326,823 R60G probably benign Het
4930596D02Rik T G 14: 35,811,478 N111T probably benign Het
9930021J03Rik A G 19: 29,754,788 S342P probably damaging Het
Abca1 T C 4: 53,081,953 D769G possibly damaging Het
Adcy6 G T 15: 98,604,215 Q173K probably benign Het
Amotl1 G A 9: 14,548,773 A890V probably benign Het
Arfgap2 C T 2: 91,267,361 A141V probably benign Het
Asb2 G A 12: 103,325,552 P324L probably damaging Het
Cacna1g G A 11: 94,463,483 T202I probably damaging Het
Capn5 A G 7: 98,132,891 L214P probably damaging Het
Cdh20 A T 1: 104,975,051 D489V possibly damaging Het
Cers5 C A 15: 99,747,024 probably benign Het
Chrnb3 T A 8: 27,393,364 V111D probably damaging Het
Colec12 C T 18: 9,858,921 P568L unknown Het
Cyp2r1 T C 7: 114,550,408 E248G probably damaging Het
Dnmt3b A G 2: 153,675,018 T536A probably benign Het
Eef2 G A 10: 81,180,292 V496M possibly damaging Het
Fam118a T C 15: 85,045,880 probably benign Het
Fer1l6 T A 15: 58,637,914 probably null Het
Fhad1 A C 4: 141,955,340 F497V probably benign Het
Gbe1 G A 16: 70,478,386 G358D probably damaging Het
Gdf10 A G 14: 33,924,101 D69G probably damaging Het
Ggt6 A G 11: 72,436,818 H150R possibly damaging Het
Gm1966 A T 7: 106,601,821 Y739N probably damaging Het
Gm45713 A T 7: 45,134,458 L110Q probably damaging Het
Gm9847 T C 12: 14,494,648 noncoding transcript Het
Grwd1 T C 7: 45,830,630 E51G probably damaging Het
H13 A G 2: 152,681,067 Y100C probably damaging Het
Kcne1 A C 16: 92,348,809 M49R probably damaging Het
Kcnma1 C T 14: 23,526,767 R236H probably damaging Het
Knl1 T A 2: 119,058,405 probably benign Het
Krt40 T C 11: 99,541,739 I150M probably damaging Het
Ldb2 A T 5: 44,473,499 V300E probably damaging Het
Lrp1b A T 2: 40,725,907 C3606S probably damaging Het
Lrrc42 A G 4: 107,247,720 I16T probably damaging Het
Lrrc6 A C 15: 66,454,101 D208E probably benign Het
Mtus1 G T 8: 41,002,361 L87I possibly damaging Het
Myot T C 18: 44,336,986 F10S probably damaging Het
Nrg3 A T 14: 38,376,456 H480Q probably damaging Het
Olfr205 A T 16: 59,329,420 F30I probably damaging Het
Olfr691 G A 7: 105,336,922 R265C probably benign Het
Prl2c5 A T 13: 13,191,805 D220V probably damaging Het
Rbm17 G A 2: 11,587,779 S295L probably benign Het
Serpina6 A G 12: 103,646,913 I376T probably damaging Het
Sh2d2a A T 3: 87,849,423 T192S probably benign Het
Slc27a1 T C 8: 71,584,462 Y417H possibly damaging Het
Slc6a1 T G 6: 114,304,852 I32S possibly damaging Het
Sntb1 T C 15: 55,906,144 T150A probably damaging Het
Tanc1 T A 2: 59,835,447 C1183* probably null Het
Ubac1 A T 2: 26,021,428 V36E possibly damaging Het
Zfc3h1 T C 10: 115,406,725 probably benign Het
Zfp644 C T 5: 106,636,905 C592Y probably damaging Het
Other mutations in Tmprss7
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00157:Tmprss7 APN 16 45663368 missense probably benign
IGL00985:Tmprss7 APN 16 45662322 missense probably damaging 1.00
IGL01115:Tmprss7 APN 16 45660789 missense probably damaging 1.00
IGL01296:Tmprss7 APN 16 45684574 missense probably damaging 0.98
IGL01298:Tmprss7 APN 16 45664175 missense probably benign 0.00
IGL01459:Tmprss7 APN 16 45663343 missense probably benign 0.00
IGL01785:Tmprss7 APN 16 45680634 missense probably damaging 1.00
IGL02313:Tmprss7 APN 16 45681593 missense probably damaging 1.00
IGL02893:Tmprss7 APN 16 45669528 missense possibly damaging 0.65
IGL02940:Tmprss7 APN 16 45656455 missense probably damaging 1.00
IGL03291:Tmprss7 APN 16 45680748 missense probably benign
fusion UTSW 16 45690760 missense probably damaging 1.00
steely UTSW 16 45667606 nonsense probably null
P0019:Tmprss7 UTSW 16 45680733 missense probably benign
R0051:Tmprss7 UTSW 16 45673939 missense probably damaging 1.00
R0051:Tmprss7 UTSW 16 45673939 missense probably damaging 1.00
R0092:Tmprss7 UTSW 16 45667596 missense probably damaging 1.00
R0219:Tmprss7 UTSW 16 45656457 missense probably damaging 1.00
R0332:Tmprss7 UTSW 16 45680638 missense probably benign 0.01
R0607:Tmprss7 UTSW 16 45669551 missense probably damaging 0.97
R0669:Tmprss7 UTSW 16 45677962 nonsense probably null
R0783:Tmprss7 UTSW 16 45667606 nonsense probably null
R1447:Tmprss7 UTSW 16 45680670 missense probably benign
R1538:Tmprss7 UTSW 16 45679390 missense probably benign 0.44
R1564:Tmprss7 UTSW 16 45662153 critical splice donor site probably null
R1912:Tmprss7 UTSW 16 45656548 nonsense probably null
R1932:Tmprss7 UTSW 16 45684593 nonsense probably null
R2257:Tmprss7 UTSW 16 45686333 missense possibly damaging 0.47
R3840:Tmprss7 UTSW 16 45660832 nonsense probably null
R4232:Tmprss7 UTSW 16 45656573 missense probably damaging 1.00
R4332:Tmprss7 UTSW 16 45686327 missense probably benign 0.00
R4685:Tmprss7 UTSW 16 45679348 missense probably benign
R4712:Tmprss7 UTSW 16 45690760 missense probably damaging 1.00
R4822:Tmprss7 UTSW 16 45663316 missense probably damaging 1.00
R5368:Tmprss7 UTSW 16 45660889 missense probably damaging 1.00
R5386:Tmprss7 UTSW 16 45669528 missense possibly damaging 0.65
R5468:Tmprss7 UTSW 16 45656448 missense probably damaging 1.00
R5526:Tmprss7 UTSW 16 45660904 missense probably damaging 1.00
R5719:Tmprss7 UTSW 16 45686430 missense probably damaging 0.99
R6149:Tmprss7 UTSW 16 45673905 nonsense probably null
R6235:Tmprss7 UTSW 16 45658122 missense probably benign 0.03
R6358:Tmprss7 UTSW 16 45669573 missense probably benign 0.00
R6645:Tmprss7 UTSW 16 45690963 missense possibly damaging 0.90
R7187:Tmprss7 UTSW 16 45677954 missense possibly damaging 0.50
R7222:Tmprss7 UTSW 16 45690893 missense probably benign
R7634:Tmprss7 UTSW 16 45663274 missense probably benign 0.00
R7747:Tmprss7 UTSW 16 45683510 missense probably benign 0.15
R7776:Tmprss7 UTSW 16 45667651 missense probably benign 0.03
R7777:Tmprss7 UTSW 16 45660600 splice site probably null
R8222:Tmprss7 UTSW 16 45658098 missense probably damaging 0.99
T0975:Tmprss7 UTSW 16 45680733 missense probably benign
Z1176:Tmprss7 UTSW 16 45662256 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CGAACAGTGTGTCTGTCTGGGAAAG -3'
(R):5'- GGTGTCTCCTGCATGAGTCACTTC -3'

Sequencing Primer
(F):5'- TCTGGGAAAGAAGGAAAAATCTACC -3'
(R):5'- GCTTGGGATCATCTCTAATCAAGG -3'
Posted On2013-04-16