Incidental Mutation 'R2187:Spta1'
ID237851
Institutional Source Beutler Lab
Gene Symbol Spta1
Ensembl Gene ENSMUSG00000026532
Gene Namespectrin alpha, erythrocytic 1
Synonymserythroid, Spna-1, ihj, Spna1
MMRRC Submission 040189-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.884) question?
Stock #R2187 (G1)
Quality Score225
Status Not validated
Chromosome1
Chromosomal Location174172776-174248450 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 174192966 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 547 (D547G)
Ref Sequence ENSEMBL: ENSMUSP00000027817 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000027817]
Predicted Effect probably damaging
Transcript: ENSMUST00000027817
AA Change: D547G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000027817
Gene: ENSMUSG00000026532
AA Change: D547G

DomainStartEndE-ValueType
SPEC 55 153 3.62e-11 SMART
SPEC 159 259 1.84e-26 SMART
SPEC 265 365 1.56e-24 SMART
SPEC 371 471 8.35e-25 SMART
SPEC 477 577 1.19e-29 SMART
SPEC 583 682 2.43e-26 SMART
SPEC 688 788 1.3e-26 SMART
SPEC 794 894 1.66e-28 SMART
SPEC 900 1077 5.03e-19 SMART
SH3 978 1033 2.98e-15 SMART
SPEC 1083 1178 2.57e-16 SMART
SPEC 1184 1284 1.15e-27 SMART
SPEC 1290 1390 7.05e-23 SMART
SPEC 1396 1495 6.04e-22 SMART
SPEC 1501 1602 1.15e-27 SMART
SPEC 1608 1708 5.46e-29 SMART
SPEC 1714 1814 1.08e-32 SMART
SPEC 1820 1921 2.17e-23 SMART
SPEC 1927 2028 2.19e-19 SMART
SPEC 2042 2142 3.87e-11 SMART
SPEC 2156 2253 9.77e-8 SMART
low complexity region 2307 2318 N/A INTRINSIC
efhand_Ca_insen 2346 2414 2.37e-27 SMART
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Spectrin is an actin crosslinking and molecular scaffold protein that links the plasma membrane to the actin cytoskeleton, and functions in the determination of cell shape, arrangement of transmembrane proteins, and organization of organelles. It is a tetramer made up of alpha-beta dimers linked in a head-to-head arrangement. This gene is one member of a family of alpha-spectrin genes. The encoded protein is primarily composed of 22 spectrin repeats which are involved in dimer formation. It forms weaker tetramer interactions than non-erythrocytic alpha spectrin, which may increase the plasma membrane elasticity and deformability of red blood cells. Mutations in this gene result in a variety of hereditary red blood cell disorders, including elliptocytosis type 2, pyropoikilocytosis, and spherocytic hemolytic anemia. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for spontaneous mutations exhibit microcytic, hypochromic, hemolytic anemia, jaundice, and high neonatal mortality. Heterozygotes of some alleles may exhibit a mild spherocytic transition. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310050C09Rik A G 3: 92,868,615 S254P probably damaging Het
Abcg1 T A 17: 31,105,517 S245R probably damaging Het
AI597479 T A 1: 43,100,823 W70R probably damaging Het
Ankrd55 A G 13: 112,383,505 S575G probably benign Het
Bfsp2 T A 9: 103,426,777 K343* probably null Het
Cant1 A T 11: 118,408,841 Y227* probably null Het
Cd2bp2 T C 7: 127,194,791 N109D probably benign Het
Chmp6 A G 11: 119,916,736 E135G possibly damaging Het
Dsp T G 13: 38,176,407 S329R probably damaging Het
Epha5 A T 5: 84,086,364 F767L probably damaging Het
Epha7 A T 4: 28,942,648 T566S possibly damaging Het
Erap1 A T 13: 74,662,405 I288F probably damaging Het
Erich6 A G 3: 58,629,845 probably null Het
Fbxo10 A G 4: 45,058,531 V402A probably benign Het
Fndc1 T A 17: 7,741,772 I1604F probably damaging Het
Foxd4 T G 19: 24,899,855 Q327P probably damaging Het
Fxn T A 19: 24,280,489 N26I probably benign Het
Hsf5 G T 11: 87,638,184 G582C possibly damaging Het
Itga8 A G 2: 12,194,420 V522A possibly damaging Het
Lyst C T 13: 13,709,341 T2938I possibly damaging Het
Mib2 T C 4: 155,654,933 E863G possibly damaging Het
Mrgpra9 A G 7: 47,235,049 F290S probably damaging Het
Mst1 T C 9: 108,084,340 Y599H possibly damaging Het
Mylk4 T C 13: 32,722,013 I165V probably damaging Het
Nipsnap2 T C 5: 129,746,473 probably null Het
Nol8 T C 13: 49,661,999 Y528H probably benign Het
Nup93 T A 8: 94,300,850 S295R probably damaging Het
Nutm2 A T 13: 50,467,417 Q6L probably benign Het
Olfr11 A T 13: 21,639,385 I46N probably damaging Het
Olfr1445 T A 19: 12,884,255 C125S probably damaging Het
Olfr820 A G 10: 130,017,688 E109G probably damaging Het
Olfr988 T G 2: 85,353,915 S4R probably benign Het
Pip5k1a A T 3: 95,071,918 L189Q probably damaging Het
Plekha4 C T 7: 45,549,274 R574C probably damaging Het
Ppp2cb A G 8: 33,610,677 E42G possibly damaging Het
Prkd3 T A 17: 78,975,554 Q244L probably benign Het
Ptpn14 C T 1: 189,863,228 R1023* probably null Het
Ptpra A G 2: 130,504,299 T127A probably benign Het
Rad54l2 ACCTCCTCCTCCTCCTCCTCCTCCTC ACCTCCTCCTCCTCCTCCTCCTC 9: 106,753,992 probably benign Het
Rasgrf1 T C 9: 89,994,835 I751T possibly damaging Het
Rbm27 A G 18: 42,325,957 K697R probably damaging Het
Rhoa C T 9: 108,335,153 T127M probably benign Het
Rnpepl1 A G 1: 92,916,895 S370G probably null Het
Sdk1 C T 5: 142,114,574 T1453I probably damaging Het
Sel1l2 A G 2: 140,230,873 L614S probably damaging Het
Slc6a20b T A 9: 123,598,588 I419F probably damaging Het
Slc8a1 C T 17: 81,648,553 S352N possibly damaging Het
Tc2n G A 12: 101,706,544 T46I probably damaging Het
Terb1 T A 8: 104,472,884 Y476F probably benign Het
Trim12a T A 7: 104,304,192 E237D probably damaging Het
Usp47 T C 7: 112,067,191 L309P probably damaging Het
Other mutations in Spta1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00979:Spta1 APN 1 174208390 nonsense probably null
IGL01095:Spta1 APN 1 174213485 missense probably benign 0.02
IGL01144:Spta1 APN 1 174187263 missense probably benign 0.05
IGL01455:Spta1 APN 1 174203311 missense possibly damaging 0.78
IGL01541:Spta1 APN 1 174217159 missense probably benign 0.03
IGL01613:Spta1 APN 1 174208394 missense probably damaging 1.00
IGL01804:Spta1 APN 1 174244180 missense probably benign 0.42
IGL01859:Spta1 APN 1 174174372 missense probably damaging 1.00
IGL01898:Spta1 APN 1 174213862 missense probably benign 0.00
IGL02106:Spta1 APN 1 174203294 missense probably benign 0.02
IGL02166:Spta1 APN 1 174190231 missense probably damaging 1.00
IGL02224:Spta1 APN 1 174217689 critical splice donor site probably benign
IGL02318:Spta1 APN 1 174174463 missense possibly damaging 0.51
IGL02392:Spta1 APN 1 174218814 missense probably damaging 0.96
IGL02852:Spta1 APN 1 174244110 missense probably benign 0.24
IGL02861:Spta1 APN 1 174211598 missense probably damaging 1.00
IGL02982:Spta1 APN 1 174187288 missense probably benign 0.00
IGL03057:Spta1 APN 1 174181058 missense probably benign 0.19
IGL03215:Spta1 APN 1 174218743 missense probably damaging 1.00
IGL03263:Spta1 APN 1 174213918 missense probably damaging 0.99
IGL03272:Spta1 APN 1 174214144 missense probably benign 0.08
H8786:Spta1 UTSW 1 174179839 missense probably damaging 0.98
R0003:Spta1 UTSW 1 174205273 missense probably damaging 0.98
R0003:Spta1 UTSW 1 174205273 missense probably damaging 0.98
R0010:Spta1 UTSW 1 174217943 missense probably benign 0.03
R0010:Spta1 UTSW 1 174217943 missense probably benign 0.03
R0078:Spta1 UTSW 1 174207032 splice site probably benign
R0172:Spta1 UTSW 1 174230786 missense probably damaging 1.00
R0206:Spta1 UTSW 1 174192960 missense probably damaging 1.00
R0208:Spta1 UTSW 1 174192960 missense probably damaging 1.00
R0276:Spta1 UTSW 1 174217894 missense probably damaging 1.00
R0288:Spta1 UTSW 1 174243179 missense probably damaging 0.99
R0323:Spta1 UTSW 1 174218451 missense probably damaging 1.00
R0454:Spta1 UTSW 1 174213942 missense probably damaging 1.00
R0508:Spta1 UTSW 1 174224457 missense probably damaging 1.00
R0698:Spta1 UTSW 1 174181104 missense probably damaging 1.00
R0751:Spta1 UTSW 1 174184690 missense probably damaging 1.00
R0925:Spta1 UTSW 1 174174426 missense possibly damaging 0.85
R0941:Spta1 UTSW 1 174245205 unclassified probably benign
R1131:Spta1 UTSW 1 174185647 missense probably damaging 1.00
R1171:Spta1 UTSW 1 174211614 nonsense probably null
R1184:Spta1 UTSW 1 174184690 missense probably damaging 1.00
R1401:Spta1 UTSW 1 174222684 missense probably damaging 1.00
R1489:Spta1 UTSW 1 174231325 missense probably damaging 0.97
R1532:Spta1 UTSW 1 174247353 missense probably damaging 0.99
R1551:Spta1 UTSW 1 174240166 missense possibly damaging 0.94
R1555:Spta1 UTSW 1 174178749 missense probably damaging 0.99
R1566:Spta1 UTSW 1 174184706 missense probably benign 0.00
R1586:Spta1 UTSW 1 174213495 missense probably benign 0.00
R1676:Spta1 UTSW 1 174179839 missense probably damaging 0.98
R1711:Spta1 UTSW 1 174241042 missense probably damaging 1.00
R1795:Spta1 UTSW 1 174245730 missense probably damaging 1.00
R1823:Spta1 UTSW 1 174246549 missense probably benign 0.05
R1842:Spta1 UTSW 1 174195947 missense probably benign 0.00
R1867:Spta1 UTSW 1 174219839 missense probably benign 0.33
R1970:Spta1 UTSW 1 174240367 missense possibly damaging 0.88
R2042:Spta1 UTSW 1 174211647 missense probably benign 0.20
R2095:Spta1 UTSW 1 174244198 missense possibly damaging 0.75
R2125:Spta1 UTSW 1 174208344 missense possibly damaging 0.80
R2145:Spta1 UTSW 1 174212614 missense probably benign 0.00
R2158:Spta1 UTSW 1 174229258 missense probably benign 0.41
R2250:Spta1 UTSW 1 174244114 missense probably damaging 1.00
R2258:Spta1 UTSW 1 174174341 missense possibly damaging 0.76
R2319:Spta1 UTSW 1 174178656 critical splice acceptor site probably null
R3782:Spta1 UTSW 1 174208314 missense probably damaging 1.00
R4058:Spta1 UTSW 1 174241137 missense probably damaging 1.00
R4080:Spta1 UTSW 1 174214066 missense probably benign 0.00
R4081:Spta1 UTSW 1 174214066 missense probably benign 0.00
R4082:Spta1 UTSW 1 174214066 missense probably benign 0.00
R4108:Spta1 UTSW 1 174174556 missense probably benign 0.01
R4115:Spta1 UTSW 1 174240357 missense probably damaging 1.00
R4303:Spta1 UTSW 1 174179852 missense probably damaging 1.00
R4419:Spta1 UTSW 1 174247424 nonsense probably null
R4525:Spta1 UTSW 1 174207110 missense probably null 1.00
R4614:Spta1 UTSW 1 174192977 missense probably damaging 1.00
R4673:Spta1 UTSW 1 174191062 splice site probably null
R4782:Spta1 UTSW 1 174230666 missense probably benign 0.01
R4825:Spta1 UTSW 1 174244042 critical splice acceptor site probably null
R4829:Spta1 UTSW 1 174237927 missense probably benign 0.01
R4873:Spta1 UTSW 1 174175830 missense probably damaging 1.00
R4875:Spta1 UTSW 1 174175830 missense probably damaging 1.00
R4898:Spta1 UTSW 1 174237834 missense possibly damaging 0.94
R4910:Spta1 UTSW 1 174217863 splice site probably null
R4911:Spta1 UTSW 1 174185647 missense probably damaging 1.00
R4928:Spta1 UTSW 1 174191056 missense probably benign 0.15
R4959:Spta1 UTSW 1 174246608 missense probably damaging 0.97
R5009:Spta1 UTSW 1 174240223 missense possibly damaging 0.62
R5149:Spta1 UTSW 1 174247434 missense probably damaging 0.99
R5293:Spta1 UTSW 1 174195985 missense probably damaging 0.99
R5421:Spta1 UTSW 1 174215529 missense probably damaging 0.99
R5457:Spta1 UTSW 1 174217193 missense probably damaging 1.00
R5590:Spta1 UTSW 1 174175770 missense possibly damaging 0.73
R5606:Spta1 UTSW 1 174219902 missense probably damaging 1.00
R5736:Spta1 UTSW 1 174214255 critical splice donor site probably null
R5834:Spta1 UTSW 1 174184797 splice site probably null
R5845:Spta1 UTSW 1 174241096 missense probably damaging 0.97
R5987:Spta1 UTSW 1 174223328 missense probably damaging 1.00
R6102:Spta1 UTSW 1 174224520 missense probably benign 0.01
R6221:Spta1 UTSW 1 174181776 missense probably damaging 1.00
R6276:Spta1 UTSW 1 174218512 missense probably damaging 1.00
R6317:Spta1 UTSW 1 174241087 missense probably damaging 1.00
R6329:Spta1 UTSW 1 174214177 missense possibly damaging 0.60
R6352:Spta1 UTSW 1 174211646 missense possibly damaging 0.94
R6374:Spta1 UTSW 1 174214168 missense probably damaging 1.00
R6376:Spta1 UTSW 1 174203322 missense probably benign
R6387:Spta1 UTSW 1 174231333 missense probably benign 0.01
R6451:Spta1 UTSW 1 174217201 missense probably damaging 0.97
R6480:Spta1 UTSW 1 174187148 splice site probably null
R6533:Spta1 UTSW 1 174244147 missense probably damaging 1.00
R6585:Spta1 UTSW 1 174178685 missense probably damaging 1.00
R6695:Spta1 UTSW 1 174244042 critical splice acceptor site probably null
R6945:Spta1 UTSW 1 174209325 missense possibly damaging 0.89
R7020:Spta1 UTSW 1 174209352 missense probably damaging 1.00
R7086:Spta1 UTSW 1 174199484 missense probably damaging 0.98
R7087:Spta1 UTSW 1 174174510 missense probably benign
R7151:Spta1 UTSW 1 174197751 missense probably damaging 1.00
R7193:Spta1 UTSW 1 174184612 missense probably damaging 1.00
R7199:Spta1 UTSW 1 174223271 missense possibly damaging 0.61
R7219:Spta1 UTSW 1 174222637 missense probably damaging 0.96
R7343:Spta1 UTSW 1 174223349 missense probably damaging 0.99
R7372:Spta1 UTSW 1 174197635 nonsense probably null
R7472:Spta1 UTSW 1 174246499 missense probably damaging 1.00
R7516:Spta1 UTSW 1 174197783 missense probably damaging 1.00
R7627:Spta1 UTSW 1 174205378 missense probably damaging 1.00
R7770:Spta1 UTSW 1 174195981 nonsense probably null
R7784:Spta1 UTSW 1 174202451 missense probably damaging 1.00
R7804:Spta1 UTSW 1 174195905 missense possibly damaging 0.50
R7854:Spta1 UTSW 1 174218830 critical splice donor site probably null
R7862:Spta1 UTSW 1 174197785 critical splice donor site probably null
R7958:Spta1 UTSW 1 174174390 missense probably benign 0.03
R8015:Spta1 UTSW 1 174240171 missense probably damaging 1.00
R8076:Spta1 UTSW 1 174187231 missense probably benign 0.00
R8152:Spta1 UTSW 1 174217944 missense probably benign 0.03
R8235:Spta1 UTSW 1 174202386 missense probably damaging 1.00
R8284:Spta1 UTSW 1 174179821 missense probably benign 0.00
R8298:Spta1 UTSW 1 174247387 missense probably damaging 1.00
R8312:Spta1 UTSW 1 174240211 missense probably damaging 1.00
RF002:Spta1 UTSW 1 174231360 missense possibly damaging 0.62
RF018:Spta1 UTSW 1 174209319 missense probably damaging 1.00
RF020:Spta1 UTSW 1 174213444 missense probably benign 0.42
RF020:Spta1 UTSW 1 174217903 missense probably damaging 1.00
T0722:Spta1 UTSW 1 174191066 splice site probably benign
X0028:Spta1 UTSW 1 174224450 missense probably damaging 1.00
Z1176:Spta1 UTSW 1 174191051 missense probably damaging 1.00
Z1176:Spta1 UTSW 1 174240367 missense probably damaging 0.99
Z1177:Spta1 UTSW 1 174190162 missense probably benign 0.09
Z1177:Spta1 UTSW 1 174245689 missense probably benign 0.02
Predicted Primers PCR Primer
(F):5'- GTAGGATCTAGGCCATCTAACCTTC -3'
(R):5'- GCTTTTCCTGATACTGGTGCAC -3'

Sequencing Primer
(F):5'- GGCCATCTAACCTTCAAAGTGTTG -3'
(R):5'- ACAGGCCATGACTTGACTTG -3'
Posted On2014-10-02