Incidental Mutation 'R2187:Olfr988'
ID237854
Institutional Source Beutler Lab
Gene Symbol Olfr988
Ensembl Gene ENSMUSG00000075222
Gene Nameolfactory receptor 988
SynonymsGA_x6K02T2Q125-46830591-46829662, MOR203-5P
MMRRC Submission 040189-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.058) question?
Stock #R2187 (G1)
Quality Score225
Status Not validated
Chromosome2
Chromosomal Location85352428-85363227 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to G at 85353915 bp
ZygosityHeterozygous
Amino Acid Change Serine to Arginine at position 4 (S4R)
Ref Sequence ENSEMBL: ENSMUSP00000151211 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000099928] [ENSMUST00000111597] [ENSMUST00000215511]
Predicted Effect probably benign
Transcript: ENSMUST00000099928
AA Change: S4R

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000097512
Gene: ENSMUSG00000075222
AA Change: S4R

DomainStartEndE-ValueType
Pfam:7TM_GPCR_Srsx 35 284 1.5e-6 PFAM
Pfam:7tm_1 41 290 3.8e-31 PFAM
Pfam:7tm_4 139 283 3.7e-45 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000111597
AA Change: S4R

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000107224
Gene: ENSMUSG00000075222
AA Change: S4R

DomainStartEndE-ValueType
Pfam:7tm_4 31 308 8.1e-51 PFAM
Pfam:7TM_GPCR_Srsx 35 284 1.5e-6 PFAM
Pfam:7tm_1 41 290 7.4e-19 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000215511
AA Change: S4R

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.4%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310050C09Rik A G 3: 92,868,615 S254P probably damaging Het
Abcg1 T A 17: 31,105,517 S245R probably damaging Het
AI597479 T A 1: 43,100,823 W70R probably damaging Het
Ankrd55 A G 13: 112,383,505 S575G probably benign Het
Bfsp2 T A 9: 103,426,777 K343* probably null Het
Cant1 A T 11: 118,408,841 Y227* probably null Het
Cd2bp2 T C 7: 127,194,791 N109D probably benign Het
Chmp6 A G 11: 119,916,736 E135G possibly damaging Het
Dsp T G 13: 38,176,407 S329R probably damaging Het
Epha5 A T 5: 84,086,364 F767L probably damaging Het
Epha7 A T 4: 28,942,648 T566S possibly damaging Het
Erap1 A T 13: 74,662,405 I288F probably damaging Het
Erich6 A G 3: 58,629,845 probably null Het
Fbxo10 A G 4: 45,058,531 V402A probably benign Het
Fndc1 T A 17: 7,741,772 I1604F probably damaging Het
Foxd4 T G 19: 24,899,855 Q327P probably damaging Het
Fxn T A 19: 24,280,489 N26I probably benign Het
Hsf5 G T 11: 87,638,184 G582C possibly damaging Het
Itga8 A G 2: 12,194,420 V522A possibly damaging Het
Lyst C T 13: 13,709,341 T2938I possibly damaging Het
Mib2 T C 4: 155,654,933 E863G possibly damaging Het
Mrgpra9 A G 7: 47,235,049 F290S probably damaging Het
Mst1 T C 9: 108,084,340 Y599H possibly damaging Het
Mylk4 T C 13: 32,722,013 I165V probably damaging Het
Nipsnap2 T C 5: 129,746,473 probably null Het
Nol8 T C 13: 49,661,999 Y528H probably benign Het
Nup93 T A 8: 94,300,850 S295R probably damaging Het
Nutm2 A T 13: 50,467,417 Q6L probably benign Het
Olfr11 A T 13: 21,639,385 I46N probably damaging Het
Olfr1445 T A 19: 12,884,255 C125S probably damaging Het
Olfr820 A G 10: 130,017,688 E109G probably damaging Het
Pip5k1a A T 3: 95,071,918 L189Q probably damaging Het
Plekha4 C T 7: 45,549,274 R574C probably damaging Het
Ppp2cb A G 8: 33,610,677 E42G possibly damaging Het
Prkd3 T A 17: 78,975,554 Q244L probably benign Het
Ptpn14 C T 1: 189,863,228 R1023* probably null Het
Ptpra A G 2: 130,504,299 T127A probably benign Het
Rad54l2 ACCTCCTCCTCCTCCTCCTCCTCCTC ACCTCCTCCTCCTCCTCCTCCTC 9: 106,753,992 probably benign Het
Rasgrf1 T C 9: 89,994,835 I751T possibly damaging Het
Rbm27 A G 18: 42,325,957 K697R probably damaging Het
Rhoa C T 9: 108,335,153 T127M probably benign Het
Rnpepl1 A G 1: 92,916,895 S370G probably null Het
Sdk1 C T 5: 142,114,574 T1453I probably damaging Het
Sel1l2 A G 2: 140,230,873 L614S probably damaging Het
Slc6a20b T A 9: 123,598,588 I419F probably damaging Het
Slc8a1 C T 17: 81,648,553 S352N possibly damaging Het
Spta1 A G 1: 174,192,966 D547G probably damaging Het
Tc2n G A 12: 101,706,544 T46I probably damaging Het
Terb1 T A 8: 104,472,884 Y476F probably benign Het
Trim12a T A 7: 104,304,192 E237D probably damaging Het
Usp47 T C 7: 112,067,191 L309P probably damaging Het
Other mutations in Olfr988
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02458:Olfr988 APN 2 85353662 missense probably benign 0.01
IGL02651:Olfr988 APN 2 85353050 missense probably damaging 1.00
R0505:Olfr988 UTSW 2 85353749 missense possibly damaging 0.87
R1574:Olfr988 UTSW 2 85353899 missense probably damaging 0.97
R1574:Olfr988 UTSW 2 85353899 missense probably damaging 0.97
R1632:Olfr988 UTSW 2 85353242 missense possibly damaging 0.78
R2251:Olfr988 UTSW 2 85353858 missense possibly damaging 0.87
R2252:Olfr988 UTSW 2 85353858 missense possibly damaging 0.87
R2253:Olfr988 UTSW 2 85353858 missense possibly damaging 0.87
R3522:Olfr988 UTSW 2 85353003 missense probably benign 0.06
R4804:Olfr988 UTSW 2 85353081 missense probably benign 0.22
R4855:Olfr988 UTSW 2 85353449 missense possibly damaging 0.89
R4895:Olfr988 UTSW 2 85352997 makesense probably null
R4918:Olfr988 UTSW 2 85353288 missense probably benign 0.39
R5171:Olfr988 UTSW 2 85353770 missense probably benign 0.11
R5208:Olfr988 UTSW 2 85353798 missense probably benign 0.07
R5938:Olfr988 UTSW 2 85353276 missense probably damaging 1.00
R6088:Olfr988 UTSW 2 85353354 missense probably damaging 0.99
R7213:Olfr988 UTSW 2 85353556 nonsense probably null
Predicted Primers PCR Primer
(F):5'- CCCATGATGGAGATGGATGC -3'
(R):5'- TGGAACTGCATAAGCTAACATGC -3'

Sequencing Primer
(F):5'- TAACATCTTGGGAGTAATAGCTGAG -3'
(R):5'- GGATAATGTCCTCAGCCTT -3'
Posted On2014-10-02