Incidental Mutation 'R2187:Mib2'
ID237863
Institutional Source Beutler Lab
Gene Symbol Mib2
Ensembl Gene ENSMUSG00000029060
Gene Namemindbomb E3 ubiquitin protein ligase 2
Synonyms2210008I11Rik, Zzank1
MMRRC Submission 040189-MU
Accession Numbers

Ncbi RefSeq: NM_001256107.1, NM_145124.3, NM_001256108.2; MGI:2679684

Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R2187 (G1)
Quality Score225
Status Not validated
Chromosome4
Chromosomal Location155654677-155669198 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 155654933 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Glycine at position 863 (E863G)
Ref Sequence ENSEMBL: ENSMUSP00000099465 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000030937] [ENSMUST00000067081] [ENSMUST00000103176] [ENSMUST00000105598] [ENSMUST00000105600] [ENSMUST00000141108]
Predicted Effect probably benign
Transcript: ENSMUST00000030937
SMART Domains Protein: ENSMUSP00000030937
Gene: ENSMUSG00000029061

DomainStartEndE-ValueType
low complexity region 19 41 N/A INTRINSIC
ZnMc 85 256 8.39e-48 SMART
ShKT 255 291 4.06e-10 SMART
IG 307 390 4.53e-2 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000067081
SMART Domains Protein: ENSMUSP00000070527
Gene: ENSMUSG00000029062

DomainStartEndE-ValueType
low complexity region 19 48 N/A INTRINSIC
low complexity region 93 112 N/A INTRINSIC
coiled coil region 123 214 N/A INTRINSIC
low complexity region 252 259 N/A INTRINSIC
low complexity region 261 272 N/A INTRINSIC
coiled coil region 290 337 N/A INTRINSIC
low complexity region 369 383 N/A INTRINSIC
S_TKc 427 712 5.05e-93 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000103176
AA Change: E863G

PolyPhen 2 Score 0.955 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000099465
Gene: ENSMUSG00000029060
AA Change: E863G

DomainStartEndE-ValueType
Pfam:MIB_HERC2 12 78 3.4e-26 PFAM
ZnF_ZZ 85 130 6.44e-9 SMART
Pfam:MIB_HERC2 160 225 4.2e-26 PFAM
Blast:ANK 285 320 2e-13 BLAST
ANK 428 457 8.52e-4 SMART
ANK 461 490 6.71e-2 SMART
ANK 494 523 9.93e-5 SMART
ANK 527 559 1.1e2 SMART
ANK 563 593 9.21e0 SMART
ANK 597 627 3.57e-6 SMART
ANK 631 660 3.31e-1 SMART
ANK 664 709 1.73e3 SMART
Blast:ANK 733 762 9e-10 BLAST
low complexity region 763 772 N/A INTRINSIC
RING 798 832 2.55e-1 SMART
RING 877 909 1.81e-2 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000105598
SMART Domains Protein: ENSMUSP00000101223
Gene: ENSMUSG00000029062

DomainStartEndE-ValueType
low complexity region 2 13 N/A INTRINSIC
low complexity region 59 78 N/A INTRINSIC
coiled coil region 89 180 N/A INTRINSIC
low complexity region 218 225 N/A INTRINSIC
low complexity region 227 238 N/A INTRINSIC
coiled coil region 256 303 N/A INTRINSIC
low complexity region 335 349 N/A INTRINSIC
S_TKc 393 678 5.05e-93 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000105600
SMART Domains Protein: ENSMUSP00000101225
Gene: ENSMUSG00000029062

DomainStartEndE-ValueType
low complexity region 19 48 N/A INTRINSIC
low complexity region 93 112 N/A INTRINSIC
coiled coil region 123 214 N/A INTRINSIC
low complexity region 252 259 N/A INTRINSIC
low complexity region 261 272 N/A INTRINSIC
coiled coil region 290 337 N/A INTRINSIC
low complexity region 369 383 N/A INTRINSIC
S_TKc 427 712 5.05e-93 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000128204
Predicted Effect noncoding transcript
Transcript: ENSMUST00000130237
Predicted Effect noncoding transcript
Transcript: ENSMUST00000130944
Predicted Effect noncoding transcript
Transcript: ENSMUST00000139134
Predicted Effect noncoding transcript
Transcript: ENSMUST00000139242
Predicted Effect noncoding transcript
Transcript: ENSMUST00000139788
Predicted Effect probably benign
Transcript: ENSMUST00000141108
SMART Domains Protein: ENSMUSP00000122269
Gene: ENSMUSG00000029060

DomainStartEndE-ValueType
Pfam:MIB_HERC2 1 52 7.1e-17 PFAM
internal_repeat_1 82 150 7.77e-12 PROSPERO
internal_repeat_1 153 220 7.77e-12 PROSPERO
ANK 289 318 8.52e-4 SMART
ANK 322 351 6.71e-2 SMART
Pfam:Ank 356 375 2.9e-4 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000156906
Predicted Effect noncoding transcript
Transcript: ENSMUST00000151843
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.4%
Validation Efficiency
MGI Phenotype Strain: 3652500; 3804450
PHENOTYPE: Mice homozygous for a knock-out allele display exencephaly with a variable penetrance that depends on the genetic background. Mice homozygous for a reporter/null allele are viable, fertile and show normal growth, body weight and brain morphology. [provided by MGI curators]
Allele List at MGI

All alleles(16) : Targeted(5) Gene trapped(11)

Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310050C09Rik A G 3: 92,868,615 S254P probably damaging Het
Abcg1 T A 17: 31,105,517 S245R probably damaging Het
AI597479 T A 1: 43,100,823 W70R probably damaging Het
Ankrd55 A G 13: 112,383,505 S575G probably benign Het
Bfsp2 T A 9: 103,426,777 K343* probably null Het
Cant1 A T 11: 118,408,841 Y227* probably null Het
Cd2bp2 T C 7: 127,194,791 N109D probably benign Het
Chmp6 A G 11: 119,916,736 E135G possibly damaging Het
Dsp T G 13: 38,176,407 S329R probably damaging Het
Epha5 A T 5: 84,086,364 F767L probably damaging Het
Epha7 A T 4: 28,942,648 T566S possibly damaging Het
Erap1 A T 13: 74,662,405 I288F probably damaging Het
Erich6 A G 3: 58,629,845 probably null Het
Fbxo10 A G 4: 45,058,531 V402A probably benign Het
Fndc1 T A 17: 7,741,772 I1604F probably damaging Het
Foxd4 T G 19: 24,899,855 Q327P probably damaging Het
Fxn T A 19: 24,280,489 N26I probably benign Het
Hsf5 G T 11: 87,638,184 G582C possibly damaging Het
Itga8 A G 2: 12,194,420 V522A possibly damaging Het
Lyst C T 13: 13,709,341 T2938I possibly damaging Het
Mrgpra9 A G 7: 47,235,049 F290S probably damaging Het
Mst1 T C 9: 108,084,340 Y599H possibly damaging Het
Mylk4 T C 13: 32,722,013 I165V probably damaging Het
Nipsnap2 T C 5: 129,746,473 probably null Het
Nol8 T C 13: 49,661,999 Y528H probably benign Het
Nup93 T A 8: 94,300,850 S295R probably damaging Het
Nutm2 A T 13: 50,467,417 Q6L probably benign Het
Olfr11 A T 13: 21,639,385 I46N probably damaging Het
Olfr1445 T A 19: 12,884,255 C125S probably damaging Het
Olfr820 A G 10: 130,017,688 E109G probably damaging Het
Olfr988 T G 2: 85,353,915 S4R probably benign Het
Pip5k1a A T 3: 95,071,918 L189Q probably damaging Het
Plekha4 C T 7: 45,549,274 R574C probably damaging Het
Ppp2cb A G 8: 33,610,677 E42G possibly damaging Het
Prkd3 T A 17: 78,975,554 Q244L probably benign Het
Ptpn14 C T 1: 189,863,228 R1023* probably null Het
Ptpra A G 2: 130,504,299 T127A probably benign Het
Rad54l2 ACCTCCTCCTCCTCCTCCTCCTCCTC ACCTCCTCCTCCTCCTCCTCCTC 9: 106,753,992 probably benign Het
Rasgrf1 T C 9: 89,994,835 I751T possibly damaging Het
Rbm27 A G 18: 42,325,957 K697R probably damaging Het
Rhoa C T 9: 108,335,153 T127M probably benign Het
Rnpepl1 A G 1: 92,916,895 S370G probably null Het
Sdk1 C T 5: 142,114,574 T1453I probably damaging Het
Sel1l2 A G 2: 140,230,873 L614S probably damaging Het
Slc6a20b T A 9: 123,598,588 I419F probably damaging Het
Slc8a1 C T 17: 81,648,553 S352N possibly damaging Het
Spta1 A G 1: 174,192,966 D547G probably damaging Het
Tc2n G A 12: 101,706,544 T46I probably damaging Het
Terb1 T A 8: 104,472,884 Y476F probably benign Het
Trim12a T A 7: 104,304,192 E237D probably damaging Het
Usp47 T C 7: 112,067,191 L309P probably damaging Het
Other mutations in Mib2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01014:Mib2 APN 4 155657730 missense probably damaging 1.00
IGL01404:Mib2 APN 4 155654936 missense probably damaging 1.00
IGL01819:Mib2 APN 4 155655258 splice site probably null
IGL02147:Mib2 APN 4 155657687 missense probably benign
IGL02260:Mib2 APN 4 155661171 missense probably damaging 1.00
IGL02472:Mib2 APN 4 155656746 missense probably damaging 1.00
IGL02632:Mib2 APN 4 155655579 missense probably damaging 0.98
IGL03051:Mib2 APN 4 155657290 missense probably damaging 1.00
IGL03077:Mib2 APN 4 155659443 missense probably benign 0.01
R0042:Mib2 UTSW 4 155659440 nonsense probably null
R0042:Mib2 UTSW 4 155659440 nonsense probably null
R0115:Mib2 UTSW 4 155656062 unclassified probably benign
R0193:Mib2 UTSW 4 155655673 missense probably benign
R0279:Mib2 UTSW 4 155661216 missense possibly damaging 0.89
R0373:Mib2 UTSW 4 155656288 missense probably damaging 1.00
R0481:Mib2 UTSW 4 155656062 unclassified probably benign
R0563:Mib2 UTSW 4 155659460 missense probably damaging 1.00
R0564:Mib2 UTSW 4 155659460 missense probably damaging 1.00
R0625:Mib2 UTSW 4 155659460 missense probably damaging 1.00
R0714:Mib2 UTSW 4 155659460 missense probably damaging 1.00
R0740:Mib2 UTSW 4 155659460 missense probably damaging 1.00
R0942:Mib2 UTSW 4 155659460 missense probably damaging 1.00
R0987:Mib2 UTSW 4 155659460 missense probably damaging 1.00
R1023:Mib2 UTSW 4 155659460 missense probably damaging 1.00
R1033:Mib2 UTSW 4 155659460 missense probably damaging 1.00
R1037:Mib2 UTSW 4 155659460 missense probably damaging 1.00
R1460:Mib2 UTSW 4 155659460 missense probably damaging 1.00
R1481:Mib2 UTSW 4 155656999 missense probably benign 0.01
R1712:Mib2 UTSW 4 155654799 missense probably damaging 1.00
R2015:Mib2 UTSW 4 155657880 missense probably damaging 1.00
R2072:Mib2 UTSW 4 155659701 missense probably damaging 0.99
R2131:Mib2 UTSW 4 155655238 splice site probably null
R3751:Mib2 UTSW 4 155655284 missense probably damaging 1.00
R3752:Mib2 UTSW 4 155655284 missense probably damaging 1.00
R3753:Mib2 UTSW 4 155655284 missense probably damaging 1.00
R4381:Mib2 UTSW 4 155657612 missense possibly damaging 0.55
R4584:Mib2 UTSW 4 155657287 missense probably damaging 1.00
R4669:Mib2 UTSW 4 155657415 missense possibly damaging 0.49
R4754:Mib2 UTSW 4 155655365 missense possibly damaging 0.90
R4782:Mib2 UTSW 4 155659772 missense probably benign 0.00
R4799:Mib2 UTSW 4 155659772 missense probably benign 0.00
R5036:Mib2 UTSW 4 155656288 missense probably damaging 1.00
R5073:Mib2 UTSW 4 155656776 missense probably damaging 1.00
R5915:Mib2 UTSW 4 155656051 unclassified probably benign
R6695:Mib2 UTSW 4 155661172 missense probably damaging 1.00
R7039:Mib2 UTSW 4 155659701 missense probably damaging 0.99
R7234:Mib2 UTSW 4 155657893 missense probably damaging 1.00
R7582:Mib2 UTSW 4 155654810 missense probably benign
R8133:Mib2 UTSW 4 155657001 missense probably benign 0.00
X0012:Mib2 UTSW 4 155655395 splice site probably null
Z1176:Mib2 UTSW 4 155661141 missense probably benign 0.06
Z1177:Mib2 UTSW 4 155655521 critical splice donor site probably null
Predicted Primers PCR Primer
(F):5'- TGCGCTCACACGAAGATCTG -3'
(R):5'- GAAGTGTATCAGGTGCCAGGTG -3'

Sequencing Primer
(F):5'- AGATCTGAATGCGGTCGC -3'
(R):5'- ATCAGGTGCCAGGTGGTCATC -3'
Posted On2014-10-02