Incidental Mutation 'R2187:Plekha4'
ID237867
Institutional Source Beutler Lab
Gene Symbol Plekha4
Ensembl Gene ENSMUSG00000040428
Gene Namepleckstrin homology domain containing, family A (phosphoinositide binding specific) member 4
Synonyms2410005C22Rik, PEPP1
MMRRC Submission 040189-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.153) question?
Stock #R2187 (G1)
Quality Score225
Status Not validated
Chromosome7
Chromosomal Location45526330-45554229 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 45549274 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Cysteine at position 574 (R574C)
Ref Sequence ENSEMBL: ENSMUSP00000148229 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000051810] [ENSMUST00000209517] [ENSMUST00000211155] [ENSMUST00000211227] [ENSMUST00000211797]
Predicted Effect probably damaging
Transcript: ENSMUST00000051810
AA Change: R574C

PolyPhen 2 Score 0.993 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000051468
Gene: ENSMUSG00000040428
AA Change: R574C

DomainStartEndE-ValueType
low complexity region 8 27 N/A INTRINSIC
PH 55 155 8.18e-19 SMART
low complexity region 162 190 N/A INTRINSIC
low complexity region 228 260 N/A INTRINSIC
low complexity region 292 303 N/A INTRINSIC
low complexity region 321 334 N/A INTRINSIC
coiled coil region 376 419 N/A INTRINSIC
low complexity region 519 535 N/A INTRINSIC
low complexity region 608 628 N/A INTRINSIC
low complexity region 649 659 N/A INTRINSIC
low complexity region 706 719 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000121932
AA Change: R574C

PolyPhen 2 Score 0.993 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000113802
Gene: ENSMUSG00000040428
AA Change: R574C

DomainStartEndE-ValueType
low complexity region 8 27 N/A INTRINSIC
PH 55 155 8.18e-19 SMART
low complexity region 162 190 N/A INTRINSIC
low complexity region 228 260 N/A INTRINSIC
low complexity region 292 303 N/A INTRINSIC
low complexity region 321 334 N/A INTRINSIC
coiled coil region 376 419 N/A INTRINSIC
low complexity region 519 535 N/A INTRINSIC
low complexity region 608 628 N/A INTRINSIC
low complexity region 649 659 N/A INTRINSIC
low complexity region 706 719 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000209517
AA Change: R574C

PolyPhen 2 Score 0.993 (Sensitivity: 0.70; Specificity: 0.97)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000210460
Predicted Effect probably benign
Transcript: ENSMUST00000210797
Predicted Effect noncoding transcript
Transcript: ENSMUST00000211106
Predicted Effect probably damaging
Transcript: ENSMUST00000211155
AA Change: R546C

PolyPhen 2 Score 0.991 (Sensitivity: 0.71; Specificity: 0.97)
Predicted Effect probably damaging
Transcript: ENSMUST00000211227
AA Change: R574C

PolyPhen 2 Score 0.972 (Sensitivity: 0.77; Specificity: 0.96)
Predicted Effect probably benign
Transcript: ENSMUST00000211348
Predicted Effect probably benign
Transcript: ENSMUST00000211797
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.4%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310050C09Rik A G 3: 92,868,615 S254P probably damaging Het
Abcg1 T A 17: 31,105,517 S245R probably damaging Het
AI597479 T A 1: 43,100,823 W70R probably damaging Het
Ankrd55 A G 13: 112,383,505 S575G probably benign Het
Bfsp2 T A 9: 103,426,777 K343* probably null Het
Cant1 A T 11: 118,408,841 Y227* probably null Het
Cd2bp2 T C 7: 127,194,791 N109D probably benign Het
Chmp6 A G 11: 119,916,736 E135G possibly damaging Het
Dsp T G 13: 38,176,407 S329R probably damaging Het
Epha5 A T 5: 84,086,364 F767L probably damaging Het
Epha7 A T 4: 28,942,648 T566S possibly damaging Het
Erap1 A T 13: 74,662,405 I288F probably damaging Het
Erich6 A G 3: 58,629,845 probably null Het
Fbxo10 A G 4: 45,058,531 V402A probably benign Het
Fndc1 T A 17: 7,741,772 I1604F probably damaging Het
Foxd4 T G 19: 24,899,855 Q327P probably damaging Het
Fxn T A 19: 24,280,489 N26I probably benign Het
Hsf5 G T 11: 87,638,184 G582C possibly damaging Het
Itga8 A G 2: 12,194,420 V522A possibly damaging Het
Lyst C T 13: 13,709,341 T2938I possibly damaging Het
Mib2 T C 4: 155,654,933 E863G possibly damaging Het
Mrgpra9 A G 7: 47,235,049 F290S probably damaging Het
Mst1 T C 9: 108,084,340 Y599H possibly damaging Het
Mylk4 T C 13: 32,722,013 I165V probably damaging Het
Nipsnap2 T C 5: 129,746,473 probably null Het
Nol8 T C 13: 49,661,999 Y528H probably benign Het
Nup93 T A 8: 94,300,850 S295R probably damaging Het
Nutm2 A T 13: 50,467,417 Q6L probably benign Het
Olfr11 A T 13: 21,639,385 I46N probably damaging Het
Olfr1445 T A 19: 12,884,255 C125S probably damaging Het
Olfr820 A G 10: 130,017,688 E109G probably damaging Het
Olfr988 T G 2: 85,353,915 S4R probably benign Het
Pip5k1a A T 3: 95,071,918 L189Q probably damaging Het
Ppp2cb A G 8: 33,610,677 E42G possibly damaging Het
Prkd3 T A 17: 78,975,554 Q244L probably benign Het
Ptpn14 C T 1: 189,863,228 R1023* probably null Het
Ptpra A G 2: 130,504,299 T127A probably benign Het
Rad54l2 ACCTCCTCCTCCTCCTCCTCCTCCTC ACCTCCTCCTCCTCCTCCTCCTC 9: 106,753,992 probably benign Het
Rasgrf1 T C 9: 89,994,835 I751T possibly damaging Het
Rbm27 A G 18: 42,325,957 K697R probably damaging Het
Rhoa C T 9: 108,335,153 T127M probably benign Het
Rnpepl1 A G 1: 92,916,895 S370G probably null Het
Sdk1 C T 5: 142,114,574 T1453I probably damaging Het
Sel1l2 A G 2: 140,230,873 L614S probably damaging Het
Slc6a20b T A 9: 123,598,588 I419F probably damaging Het
Slc8a1 C T 17: 81,648,553 S352N possibly damaging Het
Spta1 A G 1: 174,192,966 D547G probably damaging Het
Tc2n G A 12: 101,706,544 T46I probably damaging Het
Terb1 T A 8: 104,472,884 Y476F probably benign Het
Trim12a T A 7: 104,304,192 E237D probably damaging Het
Usp47 T C 7: 112,067,191 L309P probably damaging Het
Other mutations in Plekha4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01308:Plekha4 APN 7 45538235 missense probably damaging 0.97
IGL01716:Plekha4 APN 7 45534343 missense probably damaging 0.98
IGL02072:Plekha4 APN 7 45538298 missense probably benign 0.29
IGL02815:Plekha4 APN 7 45538412 missense probably damaging 1.00
IGL02939:Plekha4 APN 7 45532363 nonsense probably null
PIT4494001:Plekha4 UTSW 7 45548079 missense probably damaging 1.00
R0085:Plekha4 UTSW 7 45543949 nonsense probably null
R0239:Plekha4 UTSW 7 45532358 missense probably damaging 1.00
R0239:Plekha4 UTSW 7 45532358 missense probably damaging 1.00
R1036:Plekha4 UTSW 7 45549976 splice site probably benign
R1955:Plekha4 UTSW 7 45553906 missense probably damaging 0.99
R2049:Plekha4 UTSW 7 45553798 missense probably benign 0.01
R2888:Plekha4 UTSW 7 45538244 missense probably damaging 1.00
R5086:Plekha4 UTSW 7 45553658 missense possibly damaging 0.82
R5357:Plekha4 UTSW 7 45534771 missense probably damaging 1.00
R5604:Plekha4 UTSW 7 45549156 missense probably damaging 0.96
R5611:Plekha4 UTSW 7 45553641 missense probably benign
R6255:Plekha4 UTSW 7 45553802 utr 3 prime probably benign
R6341:Plekha4 UTSW 7 45541148 missense probably damaging 1.00
R6502:Plekha4 UTSW 7 45530576 start codon destroyed probably null 0.87
R6720:Plekha4 UTSW 7 45540886 missense possibly damaging 0.86
R6776:Plekha4 UTSW 7 45534817 missense probably damaging 1.00
R8057:Plekha4 UTSW 7 45549271 missense probably benign
Predicted Primers PCR Primer
(F):5'- GCCTTTCAGAGTCACTGGAG -3'
(R):5'- CATTGTGGTAAGCGATGGC -3'

Sequencing Primer
(F):5'- TCAGTCCCCTGAGGTGGAC -3'
(R):5'- AGGCGTTTAGTAACTACCCG -3'
Posted On2014-10-02