Incidental Mutation 'R0178:Gbe1'
ID23787
Institutional Source Beutler Lab
Gene Symbol Gbe1
Ensembl Gene ENSMUSG00000022707
Gene Nameglucan (1,4-alpha-), branching enzyme 1
Synonyms2310045H19Rik, D16Ertd536e, 2810426P10Rik
MMRRC Submission 038446-MU
Accession Numbers

Ncbi RefSeq: NM_028803.3; MGI:1921435

Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R0178 (G1)
Quality Score225
Status Validated (trace)
Chromosome16
Chromosomal Location70313949-70569716 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 70478386 bp
ZygosityHeterozygous
Amino Acid Change Glycine to Aspartic acid at position 358 (G358D)
Ref Sequence ENSEMBL: ENSMUSP00000127642 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000023393] [ENSMUST00000163832] [ENSMUST00000170464] [ENSMUST00000171132]
Predicted Effect probably damaging
Transcript: ENSMUST00000023393
AA Change: G358D

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000023393
Gene: ENSMUSG00000022707
AA Change: G358D

DomainStartEndE-ValueType
low complexity region 2 9 N/A INTRINSIC
Pfam:CBM_48 75 161 9.4e-17 PFAM
Pfam:Alpha-amylase 218 336 1.1e-17 PFAM
Pfam:Alpha-amylase_C 603 698 1.3e-24 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000163832
AA Change: G358D

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000132603
Gene: ENSMUSG00000022707
AA Change: G358D

DomainStartEndE-ValueType
low complexity region 2 9 N/A INTRINSIC
Pfam:CBM_48 75 161 6e-19 PFAM
Pfam:Alpha-amylase 220 337 5.9e-14 PFAM
Pfam:Alpha-amylase_C 603 698 2.2e-25 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000164300
Predicted Effect probably damaging
Transcript: ENSMUST00000170464
AA Change: G358D

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000131320
Gene: ENSMUSG00000022707
AA Change: G358D

DomainStartEndE-ValueType
low complexity region 2 9 N/A INTRINSIC
Pfam:CBM_48 75 161 9.4e-17 PFAM
Pfam:Alpha-amylase 218 336 1.1e-17 PFAM
Pfam:Alpha-amylase_C 603 698 1.3e-24 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000171132
AA Change: G358D

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000127642
Gene: ENSMUSG00000022707
AA Change: G358D

DomainStartEndE-ValueType
low complexity region 2 9 N/A INTRINSIC
Pfam:CBM_48 75 161 1.8e-17 PFAM
Pfam:Alpha-amylase 218 338 2.7e-18 PFAM
Pfam:Alpha-amylase_C 603 650 4.1e-12 PFAM
Meta Mutation Damage Score 0.9368 question?
Coding Region Coverage
  • 1x: 98.9%
  • 3x: 98.1%
  • 10x: 95.5%
  • 20x: 88.8%
Validation Efficiency 95% (69/73)
MGI Phenotype Strain: 4868492; 5293612
FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a glycogen branching enzyme that catalyzes the transfer of alpha-1,4-linked glucosyl units from the outer end of a glycogen chain to an alpha-1,6 position on the same or a neighboring glycogen chain. Branching of the chains is essential to increase the solubility of the glycogen molecule and, consequently, in reducing the osmotic pressure within cells. Highest level of this enzyme are found in liver and muscle. Mutations in this gene are associated with glycogen storage disease IV (also known as Andersen's disease). [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for an ENU-induced allele exhibit mid-to-late gestation lethality, decreased heart rate, glycogen storage defects, and ventricles that were small, hypertrabeculated, and noncompacted. [provided by MGI curators]
Allele List at MGI

All alleles(4) : Targeted(3) Chemically induced(1)

Other mutations in this stock
Total: 53 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700125H20Rik A G 11: 85,178,438 H94R probably benign Het
4922502D21Rik T C 6: 129,326,823 R60G probably benign Het
4930596D02Rik T G 14: 35,811,478 N111T probably benign Het
9930021J03Rik A G 19: 29,754,788 S342P probably damaging Het
Abca1 T C 4: 53,081,953 D769G possibly damaging Het
Adcy6 G T 15: 98,604,215 Q173K probably benign Het
Amotl1 G A 9: 14,548,773 A890V probably benign Het
Arfgap2 C T 2: 91,267,361 A141V probably benign Het
Asb2 G A 12: 103,325,552 P324L probably damaging Het
Cacna1g G A 11: 94,463,483 T202I probably damaging Het
Capn5 A G 7: 98,132,891 L214P probably damaging Het
Cdh20 A T 1: 104,975,051 D489V possibly damaging Het
Cers5 C A 15: 99,747,024 probably benign Het
Chrnb3 T A 8: 27,393,364 V111D probably damaging Het
Colec12 C T 18: 9,858,921 P568L unknown Het
Cyp2r1 T C 7: 114,550,408 E248G probably damaging Het
Dnmt3b A G 2: 153,675,018 T536A probably benign Het
Eef2 G A 10: 81,180,292 V496M possibly damaging Het
Fam118a T C 15: 85,045,880 probably benign Het
Fer1l6 T A 15: 58,637,914 probably null Het
Fhad1 A C 4: 141,955,340 F497V probably benign Het
Gdf10 A G 14: 33,924,101 D69G probably damaging Het
Ggt6 A G 11: 72,436,818 H150R possibly damaging Het
Gm1966 A T 7: 106,601,821 Y739N probably damaging Het
Gm45713 A T 7: 45,134,458 L110Q probably damaging Het
Gm9847 T C 12: 14,494,648 noncoding transcript Het
Grwd1 T C 7: 45,830,630 E51G probably damaging Het
H13 A G 2: 152,681,067 Y100C probably damaging Het
Kcne1 A C 16: 92,348,809 M49R probably damaging Het
Kcnma1 C T 14: 23,526,767 R236H probably damaging Het
Knl1 T A 2: 119,058,405 probably benign Het
Krt40 T C 11: 99,541,739 I150M probably damaging Het
Ldb2 A T 5: 44,473,499 V300E probably damaging Het
Lrp1b A T 2: 40,725,907 C3606S probably damaging Het
Lrrc42 A G 4: 107,247,720 I16T probably damaging Het
Lrrc6 A C 15: 66,454,101 D208E probably benign Het
Mtus1 G T 8: 41,002,361 L87I possibly damaging Het
Myot T C 18: 44,336,986 F10S probably damaging Het
Nrg3 A T 14: 38,376,456 H480Q probably damaging Het
Olfr205 A T 16: 59,329,420 F30I probably damaging Het
Olfr691 G A 7: 105,336,922 R265C probably benign Het
Prl2c5 A T 13: 13,191,805 D220V probably damaging Het
Rbm17 G A 2: 11,587,779 S295L probably benign Het
Serpina6 A G 12: 103,646,913 I376T probably damaging Het
Sh2d2a A T 3: 87,849,423 T192S probably benign Het
Slc27a1 T C 8: 71,584,462 Y417H possibly damaging Het
Slc6a1 T G 6: 114,304,852 I32S possibly damaging Het
Sntb1 T C 15: 55,906,144 T150A probably damaging Het
Tanc1 T A 2: 59,835,447 C1183* probably null Het
Tmprss7 C A 16: 45,690,843 W57C probably damaging Het
Ubac1 A T 2: 26,021,428 V36E possibly damaging Het
Zfc3h1 T C 10: 115,406,725 probably benign Het
Zfp644 C T 5: 106,636,905 C592Y probably damaging Het
Other mutations in Gbe1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01783:Gbe1 APN 16 70478369 missense probably damaging 1.00
IGL01783:Gbe1 APN 16 70401855 critical splice donor site probably null
IGL02437:Gbe1 APN 16 70434658 splice site probably benign
IGL02635:Gbe1 APN 16 70569014 missense probably damaging 1.00
IGL02836:Gbe1 APN 16 70561095 missense possibly damaging 0.90
IGL03331:Gbe1 APN 16 70433578 missense probably damaging 1.00
IGL03138:Gbe1 UTSW 16 70529063 utr 3 prime probably benign
PIT4515001:Gbe1 UTSW 16 70441116 nonsense probably null
R0044:Gbe1 UTSW 16 70561132 nonsense probably null
R0044:Gbe1 UTSW 16 70561132 nonsense probably null
R0131:Gbe1 UTSW 16 70360852 splice site probably benign
R0374:Gbe1 UTSW 16 70483914 missense probably benign 0.09
R1036:Gbe1 UTSW 16 70528887 missense probably damaging 1.00
R1162:Gbe1 UTSW 16 70381850 intron probably benign
R1759:Gbe1 UTSW 16 70488041 missense probably benign 0.11
R1780:Gbe1 UTSW 16 70495324 nonsense probably null
R1998:Gbe1 UTSW 16 70569041 missense probably damaging 1.00
R2001:Gbe1 UTSW 16 70528926 missense probably damaging 1.00
R2002:Gbe1 UTSW 16 70528926 missense probably damaging 1.00
R2269:Gbe1 UTSW 16 70436952 missense probably damaging 1.00
R2353:Gbe1 UTSW 16 70437021 splice site probably null
R2434:Gbe1 UTSW 16 70441212 missense probably damaging 1.00
R4114:Gbe1 UTSW 16 70483827 missense possibly damaging 0.64
R4528:Gbe1 UTSW 16 70478337 missense probably benign
R4736:Gbe1 UTSW 16 70495253 missense probably damaging 1.00
R4859:Gbe1 UTSW 16 70478401 missense probably damaging 1.00
R5884:Gbe1 UTSW 16 70528875 splice site probably null
R6222:Gbe1 UTSW 16 70529012 critical splice donor site probably null
R6527:Gbe1 UTSW 16 70433672 critical splice donor site probably null
R6770:Gbe1 UTSW 16 70314265 missense possibly damaging 0.86
R6770:Gbe1 UTSW 16 70401838 missense probably damaging 1.00
R6941:Gbe1 UTSW 16 70433556 small deletion probably benign
R7193:Gbe1 UTSW 16 70495370 missense probably damaging 1.00
R7232:Gbe1 UTSW 16 70436940 missense possibly damaging 0.91
R7343:Gbe1 UTSW 16 70361015 missense probably benign 0.09
R7810:Gbe1 UTSW 16 70527197 missense possibly damaging 0.92
R7822:Gbe1 UTSW 16 70433612 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- AGTACGTGTCTCCTGAATATCCTGCTT -3'
(R):5'- GGTCAGTCTAGCATATCCAGCAGTCTT -3'

Sequencing Primer
(F):5'- CCATAATCCAAACACGTGCTATG -3'
(R):5'- TGATAGCAGCAGAAATGTCTACC -3'
Posted On2013-04-16